Genomic Feature
p303
Notes
Comment | Citation |
---|---|
null allele. indel in exon 17 of nf1b resulting in premature stop codon. ... | ZFIN Staff |
Variants
- Variant Type
- Delins
- Variant Location
- Chr 10: 37291947 - 37291949 (GRCz11) (1) Details
- Nucleotide change
- TGT/CGTTTCCGTTTCC
- Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- 13 bp inserted / 3 bp deleted in Exon 17 (1)
- Transcript Consequence
- Frameshift, Premature Stop (2)
- Protein Consequence
- Polypeptide Truncation (1)
- Flanking Sequence
-
CGCTTTAAATAAAGTGTATTATATAATAATAATAATAATTTAAAAAGAAAAAAGGGGACAATAAGATGGATAAAGTGTATAAAAAGGAAGTGACCTTGATCATAACAATATGGCACGTTATGCACTAGTGTTTTTTTTATTAAAAAATGTCATTAAAGGGCGTCCCGAGTTCGAATCCCAGCTCGAGGACATTTCCCTACCCTACCCCCCCCTCTCTCTCTCCAACTTTGCTTCCTGTCTAAATACTGTACTATGTAATAAAGGCAAAAAAGGCAAAAAAAAATCTTTAAAAAAATGTAAATAAAGCATAAACTTATTTAAATACATACTTTATTTTTTCTTGTATCTATTGTGTTTTTGTTATAAGGATCGGGCCACAGTGGGCAGCAACATTGCTACCTGCCGGCAGGCTCAGACCAAGCTGGAGGTCTGTCTCTACATGTTCCTGTGGAGTCCAGACATGGAGGCCGTTCTAGTGGCCATGTCCTGTTTCCGTTACC
TGT/CGTTTCCGTTTCC GTGAGGAGGCAGAAATCCGGTGCGGTGTTGAAGACATCCCAGTGCAGTCTCTTCTGCCAAACTACAACACCTTCATGGAGTTTGCCTCTGTCAGTAACATGATGGTCACAGGTCTGTTTCATCAAACTCAGCTGTCTTCACATTTAGGAGTAATGTTTTTGCTATTGGCTCCAGCAGAGGGCAGCACATTACAACTGCATTCACTAATATTGACACACTTGCTGAATATGAGCTCTATTGCTACTATATAATATATGCTAATGTTTCCATTGATTAACCTTTTAATCTTTTGTGTTAGGATTAAAAATGAAAATATTACCAAAGTCTCATTTAGACTCTCACTCAAGGAAAAGTGTATTATGATTTTACTAGAGAATGTTTTAGAATTTGAATGAAATGTTAAATTGATAAACTTAATTTAAATTTTAATTCCTGGTTCCTAGCAAGCATATTTTTCACTATATTTCCTGTGAAATTTTTCTTCTCAATAAAGTCTTATG - Additional Sequence
- None
Fish
Fish | Genomic Feature Zygosity | Parental Zygosity | Affected Genomic Regions | Phenotype | Gene Expression |
---|---|---|---|---|---|
nf1bp303/p303 | Homozygous | ♀+/- ♂+/- | Fig. 1 from Wolman et al., 2014 | ||
nf1bp303/p303 | Homozygous | Unknown | Fig. 5 ![]() | Fig. 1 ![]() | |
nf1ap301/p301; nf1bp303/p303 | Complex | 7 figures ![]() | 2 figures ![]() | ||
nf1ap301/p301; nf1bp303/p303; ba2Tg | Complex | Fig. 2 ![]() | Fig. 2 ![]() | ||
nf1ap301/p301; nf1bp303/p303; vu12Tg | Complex | 2 figures ![]() | 2 figures ![]() | ||
nf1ap301/p301; nf1bp303/+ | Complex | Fig. 1 from Wolman et al., 2014 | |||
nf1ap301/+; nf1bp303/p303 | Complex | Fig. 1 from Wolman et al., 2014 | |||
tp53zdf1/zdf1; nf1bp303/p303 | Complex | Fig 3 ![]() | |||
tp53zdf1/zdf1; atrxzdf37/+; nf1bp303/p303 | Complex | 2 figures ![]() | |||
tp53zdf1/zdf1; nf1ap301/+; nf1bp303/p303 | Complex | 3 figures ![]() | Fig. 7 ![]() |
1 - 10 of 15
Show
Supplemental Information
- Genotyping protocol
- None
- Xu, B., Kucenas, S., Zong, H. (2022) zMADM (zebrafish mosaic analysis with double markers) for single-cell gene knockout and dual-lineage tracing. Proceedings of the National Academy of Sciences of the United States of America. 119(9)
- He, S., Zimmerman, M.W., Layden, H.M., Berezovskaya, A., Etchin, J., Martel, M.W., Thurston, G., Jing, C.B., van Rooijen, E., Kaufman, C.K., Rodig, S.J., Zon, L.I., Patton, E.E., Mansour, M.R., Look, A.T. (2021) Synergistic melanoma cell death mediated by inhibition of both MCL1 and BCL2 in high-risk tumors driven by NF1/PTEN loss. Oncogene. 40(38):5718-5729
- Oppel, F., Ki, D.H., Zimmermann, M.W., Ross, K.N., Tao, T., Shi, H., He, S., Aster, J.C., Look, A.T. (2020) suz12 inactivation in p53 and nf1 deficient zebrafish accelerates the onset of MPNSTs and expands the spectrum of tumor types to include adenocarcinoma, leukemia, and soft tissue sarcoma. Disease models & mechanisms. 13(8):
- Bremer, J., Marsden, K.C., Miller, A., Granato, M. (2019) The ubiquitin ligase PHR promotes directional regrowth of spinal zebrafish axons. Communications biology. 2:195
- Ki, D.H., Oppel, F., Durbin, A.D., Look, A.T. (2019) Mechanisms underlying synergy between DNA topoisomerase I-targeted drugs and mTOR kinase inhibitors in NF1-associated malignant peripheral nerve sheath tumors. Oncogene. 38(39):6585-6598
- Oppel, F., Tao, T., Shi, H., Ross, K.N., Zimmerman, M.W., He, S., Tong, G., Aster, J.C., Look, A.T. (2019) Loss of atrx cooperates with p53-deficiency to promote the development of sarcomas and other malignancies. PLoS Genetics. 15:e1008039
- Randlett, O., Haesemeyer, M., Forkin, G., Shoenhard, H., Schier, A.F., Engert, F., Granato, M. (2019) Distributed Plasticity Drives Visual Habituation Learning in Larval Zebrafish. Current biology : CB. 29(8):1337-1345.e4
- Ki, D.H., He, S., Rodig, S., Look, A.T. (2017) Overexpression of PDGFRA cooperates with loss of NF1 and p53 to accelerate the molecular pathogenesis of malignant peripheral nerve sheath tumors. Oncogene. 36(8):1058-1068
- Wolman, M.A., de Groh, E.D., McBride, S.M., Jongens, T.A., Granato, M., Epstein, J.A. (2014) Modulation of cAMP and Ras Signaling Pathways Improves Distinct Behavioral Deficits in a Zebrafish Model of Neurofibromatosis Type 1. Cell Reports. 8(5):1265-70
- Shin, J., Padmanabhan, A., de Groh, E.D., Lee, J.S., Haidar, S., Dahlberg, S., Guo, F., He, S., Wolman, M.A., Granato, M., Lawson, N.D., Wolfe, S.A., Kim, S.H., Solnica-Krezel, L., Kanki, J.P., Ligon, K.L., Epstein, J.A., and Look, A.T. (2012) Zebrafish neurofibromatosis type 1 genes have redundant functions in tumorigenesis and embryonic development. Disease models & mechanisms. 5(6):881-894
1 - 10 of 10
Show