Genomic Feature
vu242
- ID
- ZDB-ALT-110414-1
- Name
- vu242
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one point mutation (1)
- Protocol
- adult males treated with ENU
- Lab of Origin
- Lila Solnica-Krezel Lab - Vanderbilt University
- Current Source
- Other Pages
Notes
No data available
Variants
- Variant Type
- Point Mutation
- Variant Location
- Chr 1: 54244131 (GRCz11) (1) Details
- Nucleotide change
- C/A
- Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- C>A (1)
- Transcript Consequence
- Premature Stop (1)
- Protein Consequence
- Tyr>Stop at position 1031 (1)
- Flanking Sequence
-
AATGTATCAGAATTGGATGAATCATTAAATCAAATCGGATGAATCGGATTTATCAGAATTGGATGAATCAGAATTCAATGACTCAGAATTAGATGAACTGGATTAATCATAATAGGATGAATCATAGTCATAATTGCCTGAATCATAATTGGCTGAATCAGAATCAGATGAATTGGATGAATTAGAATTGAATGAATCAGAATTGGGTGAATCAGAATTGGATGAATCAGAATTTAATGAATCAGAATCAGTAACACAGAATCAGTGAATCGGAATGAATGTGTGTTTAGGCCTGTGTGTGTGCGTGCAATCTGCTTCAGCACTGATTGACTGTCAGGTTGTGAGTGTGTGCTGTGCCCCGTCCTGTGCAGGATGCAGACGTCCAGCACCACCTGCAGTCTGGGCTCAGCTGATGAGAACGCTGTGATGCAGGCGGACGACGCTCTGAAGACAGTCCATCTGGAGCTCACAGAGACCTGCCTGGACATGATGGCCAGATA
C/A GTCTTCTCCAACTTCTCTGCTCTGCCCAAGAGGTGCGCGCAGCCATCGTAATGATGACTAGATGAAGAAATTATAACAAATGGCTCAAATTAATTAATTTAAAAATGAACTCGAAATTAAAACATTGATTAATTATTTCTGTGGAACATTGTTACAGGTGTAGAGCAATATATAAGATGCAGTCCATCTCTATTGTAGTGTGTTGTTTTCAGCAGGAGAAAGGCAAGCTTCAAGTGTTTTCTGTGTGTGTTTTTCTTCTCTCAGGTCTCCCATCGCTGATTTCCTGTTATCTGGTGGTCCTAGTATGACGTGGCTGGTTGGGAATAAGTTAGTGACCATAACCACCAGCGGCGGCTCGCGAACACAAGCTCTTCTGGGTCTGGACATGACAGAGAGACATGGAGGAGGAGAAATGACCAGGTGATCGATTTATTCACTCGTCAAATTACTGGTCTGAGACCCATTCGGCAGATGAAAGAAGTCCGAAAACTAAACATGAT - Additional Sequence
- None
Fish
| Fish | Genomic Feature Zygosity | Parental Zygosity | Affected Genomic Regions | Phenotype | Gene Expression |
|---|---|---|---|---|---|
| tsc2vu242/vu242 | Homozygous | ♀+/- ♂+/- | 11 figures  from 3 publications | 2 figures from Scheldeman et al., 2017 | |
| tsc2vu242/vu242 (AB) | Homozygous | ♀+/- ♂+/- | 3 figures from Kim et al., 2011 | Fig. 2 from Kim et al., 2011 | |
| tsc2vu242/vu242 (TL) | Homozygous | ♀+/- ♂+/- | Fig. 7 from Swaminathan et al., 2018 | ||
| tsc2vu242/+ | Heterozygous | Unknown | 5 figures from 3 publications | 2 figures from 2 publications | |
| tsc2vu242/+ (AB) | Heterozygous | ♀+/- ♂+/- | Fig. 2 from Kim et al., 2011 | ||
| tsc2vu242/+; cu2Tg | Complex | Fig. 2 from Kedra et al., 2020 | Fig. 2 from Kedra et al., 2020 | ||
| tsc2vu242/+; jh1Tg | Complex | Fig. 2 from Kedra et al., 2020 | Fig. 2 from Kedra et al., 2020 | ||
| tsc2vu242/vu242; cu2Tg | Complex | Fig. 2 from Kedra et al., 2020 | Fig. 2 from Kedra et al., 2020 | ||
| tsc2vu242/vu242; jh1Tg | Complex | Fig. 2 from Kedra et al., 2020 | Fig. 2 from Kedra et al., 2020 | ||
| tsc2vu242/vu242; kca66Tg (AB) | Complex |
1 - 10 of 13
Show
Supplemental Information
- Genotyping protocol
- None
- Doszyn, O., Kedra, M., Zmorzynska, J. (2024) Hyperactive mTORC1 disrupts habenula function and light preference in zebrafish model of Tuberous sclerosis complex. iScience. 27:110149110149
- Wilson, M.L., Romano, S.N., Khatri, N., Aharon, D., Liu, Y., Kaufman, O.H., Draper, B.W., Marlow, F.L. (2024) Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios. Nature communications. 15:52485248
- De Meulemeester, A.S., Heylen, L., Siekierska, A., Mills, J.D., Romagnolo, A., Van Der Wel, N.N., Aronica, E., de Witte, P.A.M. (2022) Hyperactivation of mTORC1 in a double hit mutant zebrafish model of tuberous sclerosis complex causes increased seizure susceptibility and neurodevelopmental abnormalities. Frontiers in cell and developmental biology. 10:952832
- Zimmer, T.S., Korotkov, A., Zwakenberg, S., Jansen, F.E., Zwartkruis, F.J.T., Rensing, N.R., Wong, M., Mühlebner, A., van Vliet, E.A., Aronica, E., Mills, J.D. (2021) Upregulation of the pathogenic transcription factor SPI1/PU.1 in tuberous sclerosis complex and focal cortical dysplasia by oxidative stress. Brain pathology (Zurich, Switzerland). 31(5):e12949
- Kedra, M., Banasiak, K., Kisielewska, K., Wolinska-Niziol, L., Jaworski, J., Zmorzynska, J. (2020) TrkB hyperactivity contributes to brain dysconnectivity, epileptogenesis, and anxiety in zebrafish model of Tuberous Sclerosis Complex. Proceedings of the National Academy of Sciences of the United States of America. 117(4):2170-2179
- Serra, I., Scheldeman, C., Bazelot, M., Whalley, B.J., Dallas, M.L., de Witte, P.A.M., Williams, C.M. (2019) Cannabidiol modulates phosphorylated rpS6 signalling in a zebrafish model of Tuberous Sclerosis Complex. Behavioural brain research. 363:135-144
- Swaminathan, A., Hassan-Abdi, R., Renault, S., Siekierska, A., Riché, R., Liao, M., de Witte, P.A.M., Yanicostas, C., Soussi-Yanicostas, N., Drapeau, P., Samarut, É. (2018) Non-canonical mTOR-Independent Role of DEPDC5 in Regulating GABAergic Network Development. Current biology : CB. 28(12):1924-1937.e5
- Scheldeman, C., Mills, J.D., Siekierska, A., Serra, I., Copmans, D., Iyer, A.M., Whalley, B.J., Maes, J., Jansen, A.C., Lagae, L., Aronica, E., de Witte, P.A.M. (2017) mTOR-related neuropathology in mutant tsc2 zebrafish: Phenotypic, transcriptomic and pharmacological analysis. Neurobiology of disease. 108:225-237
- Boglev, Y., Badrock, A.P., Trotter, A.J., Du, Q., Richardson, E.J., Parslow, A.C., Markmiller, S.J., Hall, N.E., de Jong-Curtain, T.A., Ng, A.Y., Verkade, H., Ober, E.A., Field, H.A., Shin, D., Shin, C.H., Hannan, K.M., Hannan, R.D., Pearson, R.B., Kim, S.H., Ess, K.C., Lieschke, G.J., Stainier, D.Y., and Heath, J.K. (2013) Autophagy induction is a tor- and tp53-independent cell survival response in a zebrafish model of disrupted ribosome biogenesis. PLoS Genetics. 9(2):e1002379
- Kim, S.H., Kowalski, M.L., Carson, R.P., Bridges, L.R., and Ess, K.C. (2013) Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish. Disease models & mechanisms. 6(4):925-33
1 - 10 of 11
Show