ZFIN ID: ZDB-ALT-100506-20
Genomic Feature: sa116
Synonyms: sa0116 (1)
Affected Genomic Regions: ralaa (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 24: 1018570 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TCTAGTTCAGTGATGGAGAAAACGCAGAGGAATCCCTCCCCGCTGCGGAA
A/T
TAATTATCCCGAATCGCAGCGTAATCCTCCTGTCCGGCCGTGTCCAGGAT
(1)
OTHER sa116 PAGES
ZMP:sa116 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Unknown ralaasa116 ralaa Unknown

CITATIONS  (4)