Genomic Feature

hu2787

ID
ZDB-ALT-090611-7
Name
hu2787
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Hubrecht Institute
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 14: 20160043 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T at position 432 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: at position 113 (1)
Sequences
Flanking Sequence
TGGATTGAACATGAAACAATTAAGTTGTCCCAAAACAAATCTCAAAAATTGTGTTGTTTAAGCTATTTTTAAATAATTAGTTTAAACAAGCAATTTTTTGAGTGTTCACTGTAAAAATGAAGGCTTCGACACTTATCAACATTTATTCATGTTTTGCCAATACAAATCGATTAAGGTAACTCTCTCTCTTTTTGGCAAATTTAAGTTGATTGAACATAAAAGAATTAAGTTGTCCCAAAACAAATCTCAATAATTATTATTTTTTTGTTTATTTAGCTTGTTTTAAATAAGTTTGAACAAGCCAGTTTTTTTTTCGTGTAGTAGATTAAAACATTAAACATTACATTGATTCAAATTTGTTTTATGCTTGCATGAAGTTGTATGTAAATTTATGTATTTGCTAATTATTTGTGTTCACTTTCCTGCTCTTTTAGTTTTACGTTATAGAATATGCAGCCTGTGATGCCACCCTAAATGAAATCGTCACATTAGAGAGGCTA
C/T GACCTGTGAACCCCAACAAAGCAGCAACAAAGAACACCTTTCTCAAAACCAGACTAGATGTTCCTGAAGACTTGAGACAGATGTAAGTTGGTAGCTTTTTCATTATTTTAGTGGGGATTCCTGCAGCATTGGACAATACATTGAGAAATCCAGTCATAAAAAAATCATTAACTAATGCAGGATGTCATGGAGTTTGGCCAATTTTGGATAAATAAATCAAAAGCAGAGTTTTAAACTTAATCAAACTACAAAGCAGAATAGTGTATGTGAATATTAAACTGCAATGACAAAATGTGAACTTCTCTCCAGAGCTGCTTTAAAAATCCTTTATGATAATTTTTATGGTTTAATCCAGGACCACAAAACCATAAAAGTCATAAATGTCTTTTTTTTTTTTAACTGTGATTTTATATATCTTCTTAAAGCCAAATAAGTAAACTTTTCATTGATGTGTAATTTTTTAGGTTAAGACAATATTTAGCCCAGATACAACTAATTGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations