ZFIN ID: ZDB-ALT-080721-4
Genomic Feature: sa86
Synonyms: sa0086 (1)
Affected Genomic Regions: pax6b (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 15882990 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
GGTTCCTATTGATGGTAGGAAAAAATACTATGAAAGTCAATGGGTACAATCAACTAGCATTCTTCAAAATATCTCTCTAACAGAAGAAACTCAAAATGAACAAGTAAAAACTTTTTGTGTGAACTATCCCTTTAAGCATGCGTTTCTCATTCAAAAAAGGTGGACACTAATGCAAAAAAAGTGTGACCCTAATTAGTCCTGAAACCATCCTAGCAATTTTAAGGCATATTTTCTGTGTTCGTAGACCCATGATGATGCAAAAGTCCAACTGGACAATAAGAACGTAAGCGTATAATCGTTTGACGTACATTACATTAGTTCACTCTAGTCTTAAATAATGTATGTGAATTGTGTATATTGCTGTCCATTCAGGTGTCGAATGGGTGCGTGAGCAAGATTCTGGGGAGGTATTATGAGACGGGCTCCATCCGACCGCGAGCCATCGGAGGCAGCAAGCCCAGAGTAGCGACGCCTGAAGTGGTGGGCAAAATCGCACAGTA
C/A
AAGAGGGAGTGTCCATCTATATTTGCCTGGGAGATTCGGGACAGGCTGCTGTCGGAGGGTGTGTGCACCAACGATAACATACCGAGCGTGAGTGCAAATCAAACTTCATTTACATCATTTCATCAATACTTTGGTGGATAAATTTTTAATTTATCCACATTACAAGAAATTATACCTATGGAGCACTGTGTAAAGTGTTTAGTGCTTGACTTAACCTTTAATGTTGAATCAGATAAAGCTCAAGTAATTTTAAAGGGACAGTTCACCCCAAAATTTGAACTTTGCCATTGTTTACTCAACCAAACAAGGTTGAGTTTTGTTTGTTCTGTTGAAAACAAAAGAACATATTTTGAAAAACTTTGGAAACCACTGACTTCCATACTATTTGTTTTTCCTACTATAAAAGTCAATGGTAACCAGTTTCCAACATTCTTCAAAATATCTTCTTTTCTGTTCGACAATCAAAAATGGTTTGAGACAAGTAAGGTTAAGAAAATAAT
(1)
OTHER sa86 PAGES
ZMP:sa86 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous pax6bsa86/sa86 pax6b ♀+/- ♂+/-
Heterozygous pax6bsa86/+ (AB) pax6b Unknown
Unknown pax6bsa86 pax6b Unknown

CITATIONS  (10)