header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-070924-1
Genomic Feature: hu3328
Synonyms:
Affected Genomic Regions: fgfrl1a (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 14: 17447714 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TGTACATGCCGGCGTCCTCCTCCTTGGCTCGAGTGATCAGCAGTTTGTTC
A/T
AATAAGAGCCGTCAGGTCGTGACCACACGTCACCCGTGGGCAACACAACG
(1)
OTHER hu3328 PAGES
ZMP:hu3328 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Heterozygous fgfrl1ahu3328/+ (AB) fgfrl1a Unknown
Unknown fgfrl1ahu3328 fgfrl1a Unknown

CITATIONS  (4)