Morpholino Name: MO4-mir9
Targets: mir9-1 (1), mir9-2 (1), mir9-3 (1), mir9-4 (1), mir9-5 (1), mir9-6 (1), mir9-7 (1)
Sequence:
5' - GCTAGATAACCAAAGATAGCAACTA - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: RNA cleavage blocker morpholino.