Morpholino Name: MO2-gata4
Target: gata4 (1)
Sequence:
5' - TGGACGCAGACTGAGAGAAAGAGAG - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The sequence of the 2nd morpholino is correct, but was based on the ensemble record available at the time. However, the ensemble sequence has now been modified, and now the morpholino is not a perfect match. At the time it was to target intron 1- exon 2. But according to the update, it now targets intron 2-exon 3. Although it still is matched completely with the exon and most of the intron, it is now off for the last several bases of the intron.