Morpholino Name: MO3-mir182
Target: mir182 (1)
Previous Name: miR-182-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGTGTGAGTTCTACCATTGCCAAAT - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)