| Morpholino Name: | MO2-atg5 | 
    
        
        | Target: | atg5  (1) | 
    
        
    
    
        
    
    | Previous Name: | sMOatg5 (1) | 
    | 
    
        Attributions for Alias: {{control.newAlias}}
     
    
        Delete Alias: 
        
    
    (Including Attributions)
    
 | 
    
    
    
        | Sequence: | 
                        5' - GTGCCCTTAAAACCAAAAATAACAC - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | Splice-blocking MO. The author was contacted and verified the sequence of this MO (there is an extra C). |