| Morpholino Name: |
MO1-a2ml |
| Targets:
|
a2m2d (1),
a2m2e (1)
|
|
Previous Name:
|
ATG MO (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - ACAACAGCTAACATTCAGAGCCATG - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
This morpholino targets a2ml and the related neighboring gene sb:cb37, both located in a cluster of a2m-like genes on LG15. |