| Morpholino Name: |
MO1-aurkb |
| Target:
|
aurkb (1)
|
|
Previous Name:
|
MO1-stka
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - CGTGATTATCAGACTGACCTTAGTG - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
Targets the splice donor site of intron 8. |