| Morpholino Name: | MO2-spaw | 
    
        
        | Target: | spaw  (1) | 
    
    
    
        | Sequence: | 
                        5' - TGGTAGAGCTTCAACAGACTCTGCA - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | The authors indicate that this MO binds the last intron-exon boundary. In addition, this sequence also appears to be complementary to a portion of the mRNA containing both exons (AY24007). |