| Morpholino Name: |
MO4-cxcl12a |
| Target:
|
cxcl12a (1)
|
|
Previous Names:
|
S1a-2-MO (1),
SDF-1a-2-MO (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - TTGAGATCCATGTTTGCAGTGTGAA - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
Translation-blocking morpholino |