| CRISPR Name: | 
        CRISPR2-agtr1b | 
    
    
        
        | Targets:
         | 
        
            
                    
                        agtr1a  (1), 
                    
                        agtr1b  (1)
                    
            
         | 
    
    
        
    
    
        
    
    | 
        Previous Name:
        
     | 
    
            
            
                CRISPR1-agtr1a (1)
            
                
        
     | 
    
        
    
        Attributions for Alias: {{control.newAlias}}
    
    
    
 
    
        Delete Alias: 
        
    
    (Including Attributions)
    
  
     | 
    
    
        
            | 
                Source:
             | 
            
                
    
    
    
        
    
             | 
        
    
    
        | 
            Target Sequence:
         | 
        
            
                
                     
                        5' - ACTTTCGCAAGAACCTACTG - 3'
                        
                     
                    
                
                
            
         | 
    
    
    
        |   | 
        
            
                
                    (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.)
                
            
         | 
    
    
    
        | Note: | 
        This CRISPR targets both agtr1a and 1b. The sequence listed here is the target sequence for agtr1b. |