CRISPR Name: CRISPR1-pou5f3
Target: pou5f3 (1)
Source:
Target Sequence:
5' - GGGTGAACTACTACACGCCA - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)