CRISPR Name:	CRISPR1-kcnh6a
Target:	kcnh6a (1)
Source:
Target Sequence:	5' - GGTTATATCTCAGAAATGTTGT - 3'
	(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note:	Targets intron 1. The PAM site is "AGG" at the 3' end and Two additional "G"s were added at the beginning to improve binding.