Morpholino

MO1-dicer1

ID
ZDB-MRPHLNO-050225-1
Name
MO1-dicer1
Previous Names
  • Dicer-MO1 (1)
Target
Sequence
5' - CTGTAGGCCAGCCATGCTTAGAGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dicer1
Expressed Gene Anatomy Figures
bcl2l11 Fig. 5 from Weiner et al., 2019
mitfa Fig. 7 from Weiner et al., 2019
smarca2 Fig. 5 from Laue et al., 2019
sox10 Fig. 7 from Weiner et al., 2019
tyr Fig. 7 from Weiner et al., 2019
Phenotype
Phenotype resulting from MO1-dicer1
Phenotype Fish Figures
eye decreased size, abnormal WT + MO1-dicer1 Fig. S2 from Weiner et al., 2019
eye iridophore decreased area, abnormal WT + MO1-dicer1 Fig. 3 from Weiner et al., 2019
head apoptotic process increased occurrence, abnormal WT + MO1-dicer1 Fig. 5 from Weiner et al., 2019
head melanocyte decreased amount, abnormal WT + MO1-dicer1 Fig. 4,  Fig. S2 from Weiner et al., 2019
lateral larval melanophore stripe melanocyte decreased amount, abnormal WT + MO1-dicer1 Fig. 4,  Fig. S2 from Weiner et al., 2019
neural crest cell apoptotic process increased occurrence, abnormal vu234Tg + MO1-dicer1 Fig. 5 from Weiner et al., 2019
splanchnocranium morphology, abnormal WT + MO1-dicer1 Fig. 2 from Weiner et al., 2019
trunk GFP expression increased amount, abnormal ba3Tg + MO1-dicer1 Fig. 3 from Weiner et al., 2019
trunk iridophore decreased area, abnormal WT + MO1-dicer1 Fig. 3 from Weiner et al., 2019
ventral mandibular arch morphology, abnormal WT + MO1-dicer1 Fig. 2 from Weiner et al., 2019
whole organism ab24-h3 labeling decreased amount, abnormal WT + MO1-dicer1 Fig. 4 from Laue et al., 2019
whole organism tyr expression decreased amount, abnormal WT + MO1-dicer1 Fig. 7 from Weiner et al., 2019
whole organism Ab2-dicer labeling decreased amount, abnormal AB + MO1-dicer1 Fig. 1 with image from Chen et al., 2019
whole organism mitfa expression increased amount, abnormal WT + MO1-dicer1 Fig. 7 from Weiner et al., 2019
whole organism sox10 expression increased amount, abnormal WT + MO1-dicer1 Fig. 7 from Weiner et al., 2019
whole organism smarca2 expression increased amount, abnormal WT + MO1-dicer1 Fig. 5 from Laue et al., 2019
whole organism bcl2l11 expression increased amount, abnormal WT + MO1-dicer1 Fig. 5 from Weiner et al., 2019
whole organism Melanin decreased amount, abnormal WT + MO1-dicer1 Fig. 3 from Weiner et al., 2019
xanthophore increased amount, abnormal ba3Tg + MO1-dicer1 Fig. 3 from Weiner et al., 2019
Phenotype of all Fish created by or utilizing MO1-dicer1
Phenotype Fish Conditions Figures
whole organism Ab2-dicer labeling decreased amount, abnormal AB + MO1-dicer1 control Fig. 1 with image from Chen et al., 2019
whole organism ab24-h3 labeling decreased amount, abnormal WT + MO1-dicer1 control Fig. 4 from Laue et al., 2019
head melanocyte decreased amount, abnormal WT + MO1-dicer1 standard conditions Fig. 4,  Fig. S2 from Weiner et al., 2019
splanchnocranium morphology, abnormal WT + MO1-dicer1 standard conditions Fig. 2 from Weiner et al., 2019
lateral larval melanophore stripe melanocyte decreased amount, abnormal WT + MO1-dicer1 standard conditions Fig. 4,  Fig. S2 from Weiner et al., 2019
head apoptotic process increased occurrence, abnormal WT + MO1-dicer1 standard conditions Fig. 5 from Weiner et al., 2019
ventral mandibular arch morphology, abnormal WT + MO1-dicer1 standard conditions Fig. 2 from Weiner et al., 2019
whole organism sox10 expression increased amount, abnormal WT + MO1-dicer1 standard conditions Fig. 7 from Weiner et al., 2019
trunk iridophore decreased area, abnormal WT + MO1-dicer1 standard conditions Fig. 3 from Weiner et al., 2019
fin regeneration disrupted, abnormal WT + MO1-dicer1 amputation: caudal fin Fig. 1 from Thatcher et al., 2008
eye iridophore decreased area, abnormal WT + MO1-dicer1 standard conditions Fig. 3 from Weiner et al., 2019
whole organism mitfa expression increased amount, abnormal WT + MO1-dicer1 standard conditions Fig. 7 from Weiner et al., 2019
eye decreased size, abnormal WT + MO1-dicer1 standard conditions Fig. S2 from Weiner et al., 2019
whole organism Melanin decreased amount, abnormal WT + MO1-dicer1 standard conditions Fig. 3 from Weiner et al., 2019
whole organism bcl2l11 expression increased amount, abnormal WT + MO1-dicer1 standard conditions Fig. 5 from Weiner et al., 2019
whole organism smarca2 expression increased amount, abnormal WT + MO1-dicer1 standard conditions Fig. 5 from Laue et al., 2019
whole organism tyr expression decreased amount, abnormal WT + MO1-dicer1 standard conditions Fig. 7 from Weiner et al., 2019
xanthophore increased amount, abnormal ba3Tg + MO1-dicer1 standard conditions Fig. 3 from Weiner et al., 2019
trunk GFP expression increased amount, abnormal ba3Tg + MO1-dicer1 standard conditions Fig. 3 from Weiner et al., 2019
neural crest cell apoptotic process increased occurrence, abnormal vu234Tg + MO1-dicer1 standard conditions Fig. 5 from Weiner et al., 2019
retinal inner nuclear layer cell population proliferation decreased process quality, abnormal slc45a2b4/b4 + MO1-dicer1 light damage: retina, constant light, high light intensity Fig. 2 with image from Rajaram et al., 2014
retina regeneration process quality, abnormal slc45a2b4/b4 + MO1-dicer1 light damage: retina, constant light, high light intensity Fig. 2 with image from Rajaram et al., 2014
retinal inner nuclear layer cell population proliferation decreased process quality, abnormal slc45a2b4/b4; nt11Tg + MO1-dicer1 light damage: retina, constant light, high light intensity Fig. 3 with image from Rajaram et al., 2014
retina regeneration process quality, abnormal slc45a2b4/b4; nt11Tg + MO1-dicer1 light damage: retina, constant light, high light intensity Fig. 3 with image from Rajaram et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.