Morpholino

MO1-hspb7

ID
ZDB-MRPHLNO-131119-2
Name
MO1-hspb7
Previous Names
  • 7MO (1)
  • Splice acceptor site of intron 1. (1)
Target
Sequence
5' - CCTGTTCTGTCTGATGAAAAACATA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hspb7
Phenotype
Phenotype resulting from MO1-hspb7
Phenotype of all Fish created by or utilizing MO1-hspb7
Phenotype Fish Conditions Figures
Kupffer's vesicle functionality, abnormal WT + MO1-hspb7 standard conditions Fig. 9 with image from Rosenfeld et al., 2013
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-hspb7 standard conditions Fig. 6 with image from Rosenfeld et al., 2013
Kupffer's vesicle decreased width, abnormal s870Tg + MO1-hspb7 standard conditions Fig. 8 with image from Rosenfeld et al., 2013
Kupffer's vesicle ciliated cell decreased length, abnormal s870Tg + MO1-hspb7 standard conditions Fig. 8 with image from Rosenfeld et al., 2013
Kupffer's vesicle ciliated cell decreased amount, abnormal s870Tg + MO1-hspb7 standard conditions Fig. 8 with image from Rosenfeld et al., 2013
heart looping disrupted, abnormal twu34Tg + MO1-hspb7 standard conditions Fig. 2 with image from Rosenfeld et al., 2013
heart morphology, abnormal twu34Tg + MO1-hspb7 standard conditions Fig. 2 with image from Rosenfeld et al., 2013
heart development disrupted, abnormal twu34Tg + MO1-hspb7 standard conditions Fig. 12 with image from Mercer et al., 2018
embryonic heart tube formation disrupted, abnormal twu34Tg + MO1-hspb7 standard conditions Fig. 7 with image from Rosenfeld et al., 2013
heart jogging disrupted, abnormal twu34Tg + MO1-hspb7 standard conditions Fig. 5 with image from Rosenfeld et al., 2013
heart morphology, abnormal f2Tg; twu34Tg + MO1-hspb7 standard conditions Fig. 3 with image from Rosenfeld et al., 2013
heart morphology, abnormal f2Tg; twu34Tg + MO1-hspb12 + MO1-hspb7 standard conditions Fig. 3 with image from Rosenfeld et al., 2013
ventricular myocardium cardiac muscle cell decreased amount, abnormal f2Tg; twu34Tg + MO1-hspb12 + MO1-hspb7 standard conditions Fig. 3 with image from Rosenfeld et al., 2013
ventricular myocardium cardiac muscle cell decreased size, abnormal sd10Tg; sd11Tg + MO1-hspb7 standard conditions Fig. 4 with image from Rosenfeld et al., 2013
ventricular myocardium cardiac muscle cell decreased size, abnormal sd10Tg; sd11Tg + MO1-hspb12 + MO1-hspb7 standard conditions Fig. 4 with image from Rosenfeld et al., 2013
Citations