Morpholino

MO1-tardbpa

ID

ZDB-MRPHLNO-100506-2

Name

MO1-tardbpa

Previous Names

MO1-tardbpl

Target

tardbpa (1)

Sequence

5' - CCACACGAATATAGCACTCCGTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tardbpa

No data available

Phenotype

Phenotype resulting from MO1-tardbpa

Phenotype	Fish	Figures
neuromuscular junction development process quality, abnormal	WT + MO1-tardbpa	Fig. 5 from Dzieciolowska et al., 2017
presynapse assembly disrupted, abnormal	WT + MO1-tardbpa	Fig. 5 from Dzieciolowska et al., 2017
ventral root neuromuscular junction structure, abnormal	WT + MO1-tardbpa	Fig. 5 from Dzieciolowska et al., 2017
ventral root synapse decreased amount, abnormal	WT + MO1-tardbpa	Fig. 5 from Dzieciolowska et al., 2017
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-tardbpa	Fig. 2 from Dzieciolowska et al., 2017

Phenotype of all Fish created by or utilizing MO1-tardbpa

Phenotype	Fish	Conditions	Figures
ventral root neuromuscular junction structure, abnormal	WT + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
ventral root synapse decreased amount, abnormal	WT + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-tardbpa	standard conditions	Fig. 2 from Dzieciolowska et al., 2017
presynapse assembly disrupted, abnormal	WT + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
neuromuscular junction development process quality, abnormal	WT + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
swimming decreased duration, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 3 from Dzieciolowska et al., 2017
swimming decreased rate, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 3 from Dzieciolowska et al., 2017
thigmotaxis decreased process quality, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 3 from Dzieciolowska et al., 2017
ventral root neuromuscular junction structure, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
whole organism decreased life span, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 2 from Dzieciolowska et al., 2017
pericardium edematous, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 2 from Dzieciolowska et al., 2017
ventral root synapse decreased amount, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
whole organism anterior-posterior axis decreased length, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 2 from Dzieciolowska et al., 2017
locomotory behavior behavioral quality of a process, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 3 from Dzieciolowska et al., 2017
eye decreased diameter, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 2 from Dzieciolowska et al., 2017
trunk increased curvature, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 2 from Dzieciolowska et al., 2017
neuromuscular junction development process quality, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
presynapse assembly disrupted, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
postsynapse assembly disrupted, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa	standard conditions	Fig. 5 from Dzieciolowska et al., 2017
swimming behavior disrupted, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa + MO4-tp53 (AB)	standard conditions	Fig. 3 from Hewamadduma et al., 2013
axonogenesis disrupted, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa + MO4-tp53 (AB)	standard conditions	Fig. 4 from Hewamadduma et al., 2013
axonogenesis arrested, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa + MO4-tp53 (AB)	standard conditions	Fig. 4 from Hewamadduma et al., 2013
post-vent region curved, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa + MO4-tp53 (AB)	standard conditions	Fig. 3 from Hewamadduma et al., 2013
whole organism dead, abnormal	tardbpb^fh301/fh301 + MO1-tardbpa + MO4-tp53 (AB)	standard conditions	Fig. 3 from Hewamadduma et al., 2013

Citations