Morpholino

MO1-si:ch1073-384e4.1

ID
ZDB-MRPHLNO-170814-1
Name
MO1-si:ch1073-384e4.1
Previous Names
  • slincR-MO (1)
Target
Sequence
5' - GACCTAAACTCGACCTTACCAGATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice blocking MO targeting the exon/intron boundary of slincR exon 1 ; reference: Garcia et al. (2017) PubMed:28385905, ZDB-PUB-170408-7
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-si:ch1073-384e4.1
Expressed Gene Anatomy Figures
adamts3 Fig. 5 with image from Garcia et al., 2017
fabp2 Fig. 5 with image from Garcia et al., 2017
fgfr3 Fig. 5 with image from Garcia et al., 2017
notch3 Fig. 5 with image from Garcia et al., 2017
sfrp2 Fig. 5 with image from Garcia et al., 2017
sox9b Fig. 5 with image from Garcia et al., 2017
Phenotype
Phenotype resulting from MO1-si:ch1073-384e4.1
Phenotype Fish Figures
eye notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
hindbrain notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
locomotory behavior decreased occurrence, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 6 with image from Garcia et al., 2017
midbrain notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
pectoral fin bud notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
somite adamts3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
whole organism fabp2 expression decreased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
whole organism fgfr3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
whole organism sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
whole organism adamts3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
whole organism notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
whole organism sfrp2 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 Fig. 5 with image from Garcia et al., 2017
Phenotype of all Fish created by or utilizing MO1-si:ch1073-384e4.1
Phenotype Fish Conditions Figures
mandibular arch skeleton morphology, abnormal SPF 5-D + MO1-si:ch1073-384e4.1 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2018
head hemorrhagic, ameliorated SPF 5-D + MO1-si:ch1073-384e4.1 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 5 with image from Garcia et al., 2018
splanchnocranium joint morphology, abnormal SPF 5-D + MO1-si:ch1073-384e4.1 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2018
whole organism sfrp2 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
hindbrain notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
midbrain notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
pectoral fin bud notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism adamts3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
midbrain sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide Fig. 4 with image from Garcia et al., 2017
whole organism notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
otic vesicle sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
somite adamts3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism si:ch1073-384e4.1 expression decreased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
pharyngeal arch sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
whole organism fgfr3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide Fig. 4 with image from Garcia et al., 2017
eye notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism fabp2 expression decreased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism si:ch1073-384e4.1 expression decreased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide Fig. 4 with image from Garcia et al., 2017
otic vesicle sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide Fig. 4 with image from Garcia et al., 2017
eye sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
locomotory behavior decreased occurrence, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 6 with image from Garcia et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.