Morpholino

MO1-lama4

ID

ZDB-MRPHLNO-060119-6

Name

MO1-lama4

Previous Names

lama4 MO1 (1)

Target

lama4 (1)

Sequence

5' - GCCATGATTCCCCCTGCAACAACTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lama4

Expressed Gene	Anatomy	Figures
fli1	blood vasculature intersegmental vessel	Fig. 7 from Pollard et al., 2006
ihhb	notochord	Fig. 6 from Pollard et al., 2006
pxna	somite border muscle tendon junction	Fig. 4 from Postel et al., 2008

Phenotype

Phenotype resulting from MO1-lama4

Phenotype	Fish	Figures
blood vasculature broken, abnormal	WT + MO1-lama4	text only from Knöll et al., 2007
brain morphology, abnormal	WT + MO1-lama4	Fig. 6 from Pollard et al., 2006
heart decreased functionality, abnormal	WT + MO1-lama4	text only from Knöll et al., 2007
myotome morphology, abnormal	WT + MO1-lama4	Fig. 4 from Sztal et al., 2012
somite morphology, abnormal	WT + MO1-lama4	Fig. 4 from Postel et al., 2008
somite U-shaped, abnormal	WT + MO1-lama4	Fig. 3 from Sztal et al., 2012
somite border shape, abnormal	WT + MO1-lama4	Fig. 4 from Postel et al., 2008

Phenotype of all Fish created by or utilizing MO1-lama4

Phenotype	Fish	Conditions	Figures
myotome morphology, abnormal	WT + MO1-lama4	standard conditions	Fig. 4 from Sztal et al., 2012
brain morphology, abnormal	WT + MO1-lama4	standard conditions	Fig. 6 from Pollard et al., 2006
heart decreased functionality, abnormal	WT + MO1-lama4	standard conditions	text only from Knöll et al., 2007
blood vasculature broken, abnormal	WT + MO1-lama4	standard conditions	text only from Knöll et al., 2007
somite morphology, abnormal	WT + MO1-lama4	standard conditions	Fig. 4 from Postel et al., 2008
somite U-shaped, abnormal	WT + MO1-lama4	standard conditions	Fig. 3 from Sztal et al., 2012
somite border shape, abnormal	WT + MO1-lama4	standard conditions	Fig. 4 from Postel et al., 2008
brain vasculature broken, abnormal	ilk^hu801/+ + MO1-lama4	standard conditions	Fig. 3 from Knöll et al., 2007
pericardium edematous, abnormal	ilk^hu801/+ + MO1-lama4	standard conditions	Fig. 3 from Knöll et al., 2007
brain morphology, abnormal	lama1^m190/m190 + MO1-lama4 (AB)	standard conditions	Fig. 6 from Pollard et al., 2006
notochord morphology, abnormal	lama1^m190/m190 + MO1-lama4 (AB)	standard conditions	Fig. 6 from Pollard et al., 2006
angiogenesis delayed, abnormal	lama1^m190/m190 + MO1-lama4 (AB)	standard conditions	Fig. 7 from Pollard et al., 2006
intersegmental vessel aplastic, abnormal	lama1^m190/m190 + MO1-lama4 (AB)	standard conditions	Fig. 7 from Pollard et al., 2006
myotome refractivity, abnormal	lama2^{teg15a/teg15a} + MO1-lama4	standard conditions	Fig. 4 from Sztal et al., 2012
myotome morphology, abnormal	lama2^{teg15a/teg15a} + MO1-lama4	standard conditions	Fig. 4 from Sztal et al., 2012
apoptotic process increased occurrence, abnormal	lama2^{teg15a/teg15a} + MO1-lama4	standard conditions	Fig. 4 from Sztal et al., 2012
skeletal muscle cell apoptotic, abnormal	lama2^{teg15a/teg15a} + MO1-lama4	standard conditions	Fig. 4 from Sztal et al., 2012
slow muscle cell detached from myoseptum, abnormal	lama2^{teg15a/teg15a} + MO1-lama4	standard conditions	Fig. 3, Fig. 4 from Sztal et al., 2012
somite U-shaped, abnormal	lama2^{teg15a/teg15a} + MO1-lama4	standard conditions	Fig. 3 from Sztal et al., 2012
intersegmental vessel decreased length, abnormal	WT + MO1-lama1 + MO1-lama4	standard conditions	Fig. 8 from Pollard et al., 2006
angiogenesis disrupted, abnormal	WT + MO1-lama1 + MO1-lama4	standard conditions	Fig. 8 from Pollard et al., 2006

Citations