Morpholino

MO1-ctnnb1

ID
ZDB-MRPHLNO-051024-1
Name
MO1-ctnnb1
Previous Names
None
Target
Sequence
5' - ATCAAGTCAGACTGGGTAGCCATGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ctnnb1
Phenotype
Phenotype resulting from MO1-ctnnb1
Phenotype of all Fish created by or utilizing MO1-ctnnb1
Phenotype Fish Conditions Figures
whole organism decreased size, abnormal w25Tg + MO1-ctnnb1 standard conditions Fig. S5 from Upadhyay et al., 2008
brain morphology, abnormal w25Tg + MO1-ctnnb1 standard conditions Fig. S5 from Upadhyay et al., 2008
post-vent region decreased length, abnormal w25Tg + MO1-ctnnb1 standard conditions Fig. S5 from Upadhyay et al., 2008
brain decreased size, abnormal w25Tg + MO1-ctnnb1 standard conditions Fig. S5 from Upadhyay et al., 2008
liver decreased size, abnormal apchu745/+ + MO1-ctnnb1 standard conditions Fig. S1 with image from Goessling et al., 2008
liver increased size, ameliorated apchu745/+ + MO1-ctnnb1 standard conditions Fig. 2 with image from Goessling et al., 2008
liver absent, abnormal apchu745/hu745 + MO1-ctnnb1 standard conditions Fig. 2 with image from Goessling et al., 2008
liver decreased size, abnormal apchu745/hu745 + MO1-ctnnb1 standard conditions Fig. S1 with image from Goessling et al., 2008
whole organism dharma expression increased distribution, abnormal nanogihb97/ihb97 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
canonical Wnt signaling pathway increased efficacy, abnormal nanogihb97/ihb97 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism chrd expression increased amount, abnormal nanogihb97/ihb97 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism dorsalized, abnormal nanogihb97/ihb97 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism chrd expression increased distribution, abnormal nanogihb97/ihb97 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism dharma expression increased amount, abnormal nanogihb97/ihb97 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
negative regulation of canonical Wnt signaling pathway decreased occurrence, abnormal nanogihb97/ihb97 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism dharma expression increased distribution, abnormal nanogihb98/ihb98 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism dorsalized, abnormal nanogihb98/ihb98 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism chrd expression increased distribution, abnormal nanogihb98/ihb98 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
canonical Wnt signaling pathway increased efficacy, abnormal nanogihb98/ihb98 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism chrd expression increased amount, abnormal nanogihb98/ihb98 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
negative regulation of canonical Wnt signaling pathway decreased occurrence, abnormal nanogihb98/ihb98 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
whole organism dharma expression increased amount, abnormal nanogihb98/ihb98 + MO1-ctnnb1 standard conditions Fig 4 with image from He et al., 2020
digestive tract development disrupted, abnormal ruvbl2fw039k/+ + MO1-ctnnb1 standard conditions Fig. 7 from Rottbauer et al., 2002
cardiac ventricle hyperplastic, abnormal ruvbl2fw039k/+ + MO1-ctnnb1 standard conditions Fig. 7 from Rottbauer et al., 2002
digestive tract development disrupted, abnormal ruvbl2fw039k/fw039k + MO1-ctnnb1 standard conditions Fig. 7 from Rottbauer et al., 2002
cardiac ventricle hyperplastic, abnormal ruvbl2fw039k/fw039k + MO1-ctnnb1 standard conditions Fig. 7 from Rottbauer et al., 2002
trunk vasculature dll4 expression amount, ameliorated WT + MO1-ctnnb1 + MO1-ctnnb2 + MO1-ptger3 standard conditions Fig. 4 from Chen et al., 2017
Citations