Morpholino Name: MO1-mir430c
Targets: mir430c-1 (1), mir430c-2 (1), mir430c-3 (1), mir430c-4 (1), mir430c-5 (1), mir430c-7 (1), mir430c-8 (1), mir430c-9 (1), mir430c-10 (1), mir430c-11 (1), mir430c-12 (1), mir430c-13 (1), mir430c-14 (1), mir430c-15 (1), mir430c-16 (1), mir430c-17 (1), mir430c-18 (1)
Sequence:
5' - ACTACCCCAAAGAGAAGCACTTATG - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)