Morpholino Name: MO4-mir430
Targets: mir430a-1 (1), mir430a-2 (1), mir430a-3 (1), mir430a-4 (1), mir430a-5 (1), mir430a-6 (1), mir430a-7 (1), mir430a-8 (1), mir430a-9 (1), mir430a-11 (1), mir430a-12 (1), mir430a-13 (1), mir430a-14 (1), mir430a-15 (1), mir430a-16 (1), mir430a-17 (1), mir430a-18 (1), mir430b-1 (1), mir430b-2 (1), mir430b-3 (1), mir430b-4 (1), mir430b-5 (1), mir430b-6 (1), mir430b-7 (1), mir430b-8 (1), mir430b-9 (1), mir430b-10 (1), mir430b-11 (1), mir430b-12 (1), mir430b-13 (1), mir430b-14 (1), mir430b-15 (1), mir430b-16 (1), mir430b-17 (1), mir430b-18 (1), mir430b-19 (1), mir430b-20 (1), mir430c-2 (1), mir430c-6 (1), mir430c-7 (1), mir430c-8 (1), mir430c-10 (1), mir430c-11 (1), mir430c-12 (1), mir430c-13 (1), mir430c-14 (1), mir430c-15 (1), mir430c-16 (1), mir430c-17 (1), mir430c-18 (1)
Previous Name: MO1-mir430b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTACCCCAACTTGATAGCACTTTC - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This MO targets the mir430 cluster on chromosome 4.