| Morpholino Name: |
MO1-cfap161 |
| Target:
|
cfap161 (1)
|
|
Previous Names:
|
c15orf26 mo (1),
Exon4 (1),
MO1-zgc:110373
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - GTATTTTGTTGTTTACCTCTCCAGC - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
Splice blocking |