Morpholino Name: MO1-mir430a
Targets: mir430a-1 (1), mir430a-2 (1), mir430a-3 (1), mir430a-4 (1), mir430a-5 (1), mir430a-6 (1), mir430a-7 (1), mir430a-8 (1), mir430a-9 (1), mir430a-10 (1), mir430a-11 (1), mir430a-12 (1), mir430a-13 (1), mir430a-14 (1), mir430a-15 (1), mir430a-16 (1), mir430a-17 (1), mir430a-18 (1), mir430a-19 (1), mir430a-20 (1), mir430a-21 (1), mir430a-23 (1)
Previous Name: antiā€“miR-430 KD (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACTACCCCAACAAATAGCACTTACC - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)