| Morpholino Name: |
MO2-nr4a2a,nr4a2b |
| Targets:
|
nr4a2a (1),
nr4a2b (1)
|
|
Previous Names:
|
MO2-nr4a2a+nr4a2b,
nr4a2mo (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - CATACTGAGCCTGGACGCAGGGCAT - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|