Morpholino Name: |
MO1-gdf6a |
Target:
|
gdf6a (1)
|
Previous Names:
|
rdr gtMO (1),
rdrgtMO (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
Sequence:
|
5' - GCAATACAAACCTTTTCCCTTGTCC - 3'
|
|
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
Note: |
Splice-blocking morpholino, resulting in production of gdf6a mRNA containing its lone intron. This allows for normal maternal gdf6a function, as gdf6a is required for patterning the early embryo, but inhibits zygotic gdf6a function prior to eye development. As high levels of necrosis are observed in gdf6a morphants, gdf6a morpholinos were co-injected with a p53 translation blocking morpholino. -- French et al. 2007, ZDB-PUB-070726-17 |