| Morpholino Name: |
MO6-pax8 |
| Target:
|
pax8
|
|
Previous Name:
|
variant 1 MO (1)
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Sequence:
|
5' - GTTCACAAACATGCCTCCTAGTTGA - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
translation blocker for splice variant 1 (variant 1 MO). This MO blocks translation of variant 1 isoforms, which lack the N-terminal Paired domain. Reference: Mackereth et al. (2005) |