| CRISPR Name: |
CRISPR1-dre-mir-183 |
| Target:
|
dre-mir-183 (1)
|
|
Previous Name:
|
CRISPR1-mir183
|
Attributions for Alias: {{control.newAlias}}
Delete Alias:
(Including Attributions)
|
|
Source:
|
|
|
Target Sequence:
|
5' - GGAGACTCCTGTTCTGTGTA - 3'
|
| |
(Although ZFIN verifies reagent sequence data, we recommend that you
conduct independent sequence analysis before ordering any reagent.)
|
| Note: |
The first two 'G's were added to facilitate T7-dependent transcription. |