CRISPR Name: CRISPR3-aldh1a2
Target: aldh1a2 (1)
Previous Name: intron 3 ali3gR15 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GAAGAAAAATACTGTTCAAA - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)