header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2180
Transcript Name: hsp70l-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: artifact
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048953 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048953|OTTDARG00000034578|ZDB-GENE-050321-1 hsp70l|no_translation hsp70l-002 LG_ FP017299.16 Danio rerio protein_coding KNOWN, 1216 bp
ACTCAACCGAAGAGAAGCGACTTGACAAAGAAGAAAAGAG
CAGCCTGACAGGACTTTTCCCCGACGAGGTGTTTATTCGC
TCTATTTAAGAATCTACTGTAAGTTTCTTGAAATCAATCA
TGTCTTCTCCAAAAGAAATCGCTATTGGCATTGACCTGGG
CACCACCTACTCCTGTGTGGGGGTGTTTCAGCATGGAAAA
GTGGAGATCATCGCCAACGACCAGGGCAACAGAACAACAC
CCAGCTATGTTGCCTTCACAGACACAGAGAGGCTGATTGG
AGACGCAGCTAAAAACCAGGTGGCCATGAATCCCAACAAC
ACGGTGTTTGATGCCAAGAGGCTGATCGGCAGGAGGTTTG
ATGACCCTGTAGTGCAGTCTGACATGAAGCACTGGTCCTT
CAAAGTCGTCAGTGATGGAGGAAAGCCAAAAGTTGCAGTG
GAACACAAAGGAGAAAACAAGACCTTTAATCCTGAAGAGA
TTTCCTCCATGGTCCTGGTGAAGATGAAGGAGATTGCAGA
AGCTTATCTGGGGCAGAAGGTGACCAACGCAGTTATCACA
GTTCCAGCCTATTTCAACGACTCCCAGAGACAGGCCACTA
AAGATGCTGGAGTCATCGCTGGACTGAATGTGCTCCGCAT
CATCAACGAGCCCACGGCTGCAGCCATCGCCTACGGCCTG
GACAAAGGCAAATCCTCAGAGCGCAACGTGCTGATCTTTG
ACCTGGGCGGAGGCACCTTCGACGTGTCCATCCTGACCAT
TGAAGACGGCATCTTTGAGGTGAAGGCCACCGCTGGAGAC
ACTCATCTGGGCGGTGAGGACTTTGACAACCGCATGGTGA
ACCACTTTGTGGAAGACGACAACCTGAAAGGCAAGATCAG
CGAGGAGGACAAGAAGAGGGTTGTTGAGAAGTGCAATGAA
GCCGTGAGCTGGCTGGAGAACAACCAGCTGGCGGATAAAG
AGGATTATGAACTCGCATGAACGTCGTCTGTCAGTCAGAA
TCCACGTAATGTTTTGACCAAACATATTTTTATACAACAC
TGCTGCTCTTATATTTCTGTTGCTATTTAGCAACCATTCA
CCACTGTAATTTATTTAAAGTGTACATTGTGATGTAAATA
AAAGTGTAAATATTTTCATGAATTCAAAAAACTTTTATGT
AAAAAAAATATATATATGAAAATGATTAATAAAGTGTTTG
TACATGAGAACAGCAA

hsp70l TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hsp70l-002 1216
mRNA hsp70l-201 (1) 2302
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hsp70l-002 Contained in:

OTHER hsp70l-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048953 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153474 (1) 1227bp
    CITATIONS (1)