ZFIN ID: ZDB-MRPHLNO-121219-1
Morpholino Name: MO5-vegfaa
Target: vegfaa (1)
Previous Name: TP1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCAAGGAATGTTCTTCCTTAGGTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Target protector morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-vegfaa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-vegfaa No data available
PHENOTYPE
Phenotype resulting from MO5-vegfaa
No data available

Phenotype of all Fish created by or utilizing MO5-vegfaa
No data available
Genome Resources:
CITATIONS (1)