Morpholino

MO1-aqp11

ID
ZDB-MRPHLNO-110216-4
Name
MO1-aqp11
Previous Names
  • MO2 (1)
Target
Sequence
5' - CAAAAACTAATCCAGACAGGCAACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO, targets 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aqp11
No data available
Phenotype
Phenotype resulting from MO1-aqp11
No data available
Phenotype of all Fish created by or utilizing MO1-aqp11
No data available
Citations