ZFIN ID: ZDB-CRISPR-170829-15
CRISPR Name: CRISPR19-tyr
Target: tyr (1)
Previous Name: rank 16 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGAGTTCCTGACGCCGTATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR19-tyr No data available
GENOMIC FEATURES CREATED WITH CRISPR19-tyrNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR19-tyr No data available
PHENOTYPE
Phenotype resulting from CRISPR19-tyr
No data available

Phenotype of all Fish created by or utilizing CRISPR19-tyr
No data available
OTHER CRISPR19-tyr CRISPR PAGESNo links to external sites
CITATIONS (1)