Morpholino

MO1-snx5

ID

ZDB-MRPHLNO-060601-5

Name

MO1-snx5

Previous Names

None

Target

snx5 (1)

Sequence

5' - ACGTCATGTTCAGGAGATATTTCGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

MODB:554 (2)

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-snx5

No data available

Phenotype

Phenotype resulting from MO1-snx5

Phenotype	Fish	Figures
blood cell decreased amount, abnormal	sd2Tg; y1Tg + MO1-snx5	Fig. Table 1, Fig. Table S7 from Eckfeldt et al., 2005
blood circulation disrupted, abnormal	sd2Tg; y1Tg + MO1-snx5	Fig. Table S7 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	sd2Tg; y1Tg + MO1-snx5	Fig. Table 1, Fig. Table S7 from Eckfeldt et al., 2005
intersegmental vessel branchiness, abnormal	sd2Tg; y1Tg + MO1-snx5	Fig. Table S7 from Eckfeldt et al., 2005
post-vent region curved ventral, abnormal	sd2Tg; y1Tg + MO1-snx5	Fig. Table S7 from Eckfeldt et al., 2005
somite cuboid, abnormal	sd2Tg; y1Tg + MO1-snx5	Fig. Table S7 from Eckfeldt et al., 2005

Phenotype of all Fish created by or utilizing MO1-snx5

Phenotype	Fish	Conditions	Figures
blood cell decreased amount, abnormal	WT + MO1-snx5	standard conditions	Fig. Table 1 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	WT + MO1-snx5	standard conditions	Fig. Table 1 from Eckfeldt et al., 2005
Notch signaling pathway decreased process quality, abnormal	knu2Tg + MO1-snx5 + MO2-snx5	standard conditions	Fig. 3 from Olena et al., 2015
trunk vasculature blood vessel morphogenesis process quality, abnormal	la116Tg + MO1-snx5 + MO2-snx5	standard conditions	Fig. S3 from Olena et al., 2015
intersegmental vessel decreased amount, abnormal	la116Tg + MO1-snx5 + MO2-snx5	standard conditions	Fig. S3 from Olena et al., 2015
Muller cell decreased amount, abnormal	mi2001Tg + MO1-snx5 + MO2-snx5	standard conditions	Fig. 5 from Olena et al., 2015
retinal cone cell increased amount, abnormal	mi2001Tg + MO1-snx5 + MO2-snx5	standard conditions	Fig. 6 from Olena et al., 2015
blood circulation disrupted, abnormal	sd2Tg; y1Tg + MO1-snx5	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
post-vent region curved ventral, abnormal	sd2Tg; y1Tg + MO1-snx5	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
blood cell decreased amount, abnormal	sd2Tg; y1Tg + MO1-snx5	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
somite cuboid, abnormal	sd2Tg; y1Tg + MO1-snx5	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	sd2Tg; y1Tg + MO1-snx5	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
intersegmental vessel branchiness, abnormal	sd2Tg; y1Tg + MO1-snx5	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005

Citations