CRISPR

CRISPR2-cntn2

ID

ZDB-CRISPR-181105-1

Name

CRISPR2-cntn2

Previous Names

None

Target

cntn2 (1)

Sequence

5' - ATGCGGCACCATTGTTAGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zou20	cntn2
zou22	cntn2

Expression

Gene expression in Wild Types + CRISPR2-cntn2

No data available

Phenotype

Phenotype resulting from CRISPR2-cntn2

No data available

Phenotype of all Fish created by or utilizing CRISPR2-cntn2

Phenotype	Fish	Conditions	Figures
statoacoustic (VIII) ganglion cntn2 expression decreased amount, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 1 from Gurung et al., 2018
posterior lateral line ganglion cntn2 expression decreased amount, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 1 from Gurung et al., 2018
whole organism cntn2 expression absent, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 1 from Gurung et al., 2018
swimming decreased duration, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 7 from Gurung et al., 2018
anterior lateral line ganglion cntn2 expression decreased amount, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 1 from Gurung et al., 2018
medial longitudinal fasciculus axonal fasciculation decreased occurrence, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 4 from Gurung et al., 2018
statoacoustic (VIII) ganglion cntn2 expression absent, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 1 from Gurung et al., 2018
trunk startle response decreased occurrence, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 6 from Gurung et al., 2018
trunk thigmotaxis decreased occurrence, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 6 from Gurung et al., 2018
posterior lateral line ganglion cntn2 expression absent, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 1 from Gurung et al., 2018
anterior lateral line ganglion cntn2 expression absent, abnormal	cntn2^zou20/zou20	standard conditions	Fig. 1 from Gurung et al., 2018
whole organism cntn2 expression absent, abnormal	cntn2^zou22/zou22	standard conditions	Fig. 1 from Gurung et al., 2018
branchiomotor neuron neuron migration decreased occurrence, abnormal	cntn2^zou20/zou20; rw0Tg + MO1-cntn2	standard conditions	Fig. 5 from Gurung et al., 2018
nucleus of the medial longitudinal fasciculus medulla oblongata neuron loose, abnormal	cntn2^zou20/zou20; zy8Tg + MO1-cntn2	standard conditions	Fig. 5 from Gurung et al., 2018
branchiomotor neuron neuron migration decreased occurrence, abnormal	vangl2^tc240/+; cntn2^zou20/+; rw0Tg	standard conditions	Fig. 3 from Gurung et al., 2018
rhombomere 4 branchiomotor neuron mislocalised anteriorly, exacerbated	vangl2^tc240/+; cntn2^zou20/+; rw0Tg	standard conditions	Fig. 3 from Gurung et al., 2018
rhombomere 4 branchiomotor neuron mislocalised anteriorly, abnormal	vangl2^tc240/+; cntn2^zou20/+; rw0Tg	standard conditions	Fig. 3 from Gurung et al., 2018
branchiomotor neuron neuron migration decreased occurrence, exacerbated	vangl2^tc240/+; cntn2^zou20/+; rw0Tg	standard conditions	Fig. 3 from Gurung et al., 2018

Citations