Morpholino

MO2-etsrp

ID
ZDB-MRPHLNO-060407-3
Name
MO2-etsrp
Previous Names
  • EtsrpMO (1)
  • MO2-ets1b
  • MO2-etv2
  • MOetsrp (1)
Target
Sequence
5' - CACTGAGTCCTTATTTCACTATATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-etsrp
Expressed Gene Anatomy Figures
alas2 FIGURE 4 with image from Wu et al., 2022
cdh5 Fig. 4 with image from Pociute et al., 2019
Fig. 5 from Moore et al., 2018
clec14a Fig. 4 with image from Sumanas et al., 2006
dusp5 Fig. 4 with image from Sumanas et al., 2006
etsrp Fig. 4 with imageFig. 5 with image from Sumanas et al., 2006
fli1 Fig. 6 with image from Davis et al., 2018
Fig. 5 with image from Sumanas et al., 2006
flt4 Fig. 6 with image from Davis et al., 2018
Fig. 4 with image from Sumanas et al., 2006
gata1a Fig. 4 with image from Sumanas et al., 2006
gpr182 Fig. 4 with image from Sumanas et al., 2006
kdrl FIGURE 4 with image from Wu et al., 2022
Fig. 4 with image from Pociute et al., 2019
Fig. 4 with image from Liu et al., 2008
Fig. 7 with image from Sumanas et al., 2006
lyve1b Fig. 6 with image from Davis et al., 2018
sox7 Fig. S2 from Herpers et al., 2008
sox18 Fig. S2 from Herpers et al., 2008
spi1a Fig. 4 from Bukrinsky et al., 2009
spi1b Fig. 4 from Bukrinsky et al., 2009
tal1 Fig. 4 with imageFig. 5 with image from Sumanas et al., 2006
Phenotype
Phenotype resulting from MO2-etsrp
Phenotype Fish Figures
angiogenic sprout mislocalised, abnormal s843Tg + MO2-etsrp Fig. 4 with image from Pociute et al., 2019
axial blood vessel blood vessel endothelial cell decreased amount, abnormal is4Tg; s843Tg + MO2-etsrp Fig. 3 with image from Chetty et al., 2020
blood cell decreased amount, abnormal sd2Tg; tsu2013Tg + MO2-etsrp Fig. 4 with image from Qiu et al., 2016
blood vasculature EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp Fig. 2 with imageFig. 3 with imageFig. 7 with image from Chetty et al., 2020
blood vasculature morphology, abnormal WT + MO2-etsrp Fig. S2 from Herpers et al., 2008
blood vasculature EGFP expression spatial pattern, abnormal is4Tg; s843Tg + MO2-etsrp Fig. 2 with imageFig. 3 with imageFig. 7 with image from Chetty et al., 2020
blood vasculature structure, abnormal s843Tg + MO2-etsrp Fig. 2 with image from Chetty et al., 2020
blood vessel EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp Fig. 2 with imageFig. 3 with imageFig. 7 with image from Chetty et al., 2020
blood vessel EGFP expression spatial pattern, abnormal s843Tg + MO2-etsrp Fig. 2 with imageFig. 3 with imageFig. 7 with image from Chetty et al., 2020
blood vessel morphogenesis disrupted, abnormal WT + MO2-etsrp Fig. S2 from Herpers et al., 2008
dorsal aorta absent, abnormal y1Tg + MO2-etsrp Fig. 4 with image from Qiu et al., 2016
embryonic blood vessel endothelial progenitor cell kdrl expression decreased amount, abnormal WT + MO2-etsrp Fig. 4 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell cdh5 expression decreased amount, abnormal WT + MO2-etsrp Fig. 4 with image from Pociute et al., 2019
embryonic hemopoiesis disrupted, abnormal AB + MO2-etsrp Fig. 4 with image from Liu et al., 2008
endothelial cell EGFP expression absent, abnormal y1Tg + MO2-etsrp Fig. 5 with image from Chetty et al., 2020
intersegmental vessel decreased amount, abnormal s843Tg + MO2-etsrp Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp Fig. 2 with imageFig. 3 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel decreased height, abnormal s843Tg + MO2-etsrp Fig. 7 with image from Chetty et al., 2020
intersegmental vessel irregular spatial pattern, abnormal s843Tg + MO2-etsrp Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel EGFP expression spatial pattern, abnormal s843Tg + MO2-etsrp Fig. 2 with imageFig. 3 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel angiogenic sprout decreased length, abnormal s843Tg + MO2-etsrp Fig. 4 with image from Pociute et al., 2019
lymphangiogenesis decreased occurrence, abnormal ci5Tg; y1Tg + MO2-etsrp Fig. 3 with image from Davis et al., 2018
posterior cardinal vein absent, abnormal y1Tg + MO2-etsrp Fig. 4 with image from Qiu et al., 2016
posterior caudal vein lyve1b expression decreased amount, abnormal WT + MO2-etsrp Fig. 6 with image from Davis et al., 2018
posterior caudal vein flt4 expression decreased amount, abnormal WT + MO2-etsrp Fig. 6 with image from Davis et al., 2018
posterior lateral mesoderm morphology, abnormal AB + MO2-etsrp Fig. 4 with image from Liu et al., 2008
regulation of myeloid leukocyte differentiation disrupted, abnormal WT + MO2-etsrp Fig. 4 from Bukrinsky et al., 2009
sprouting angiogenesis delayed, abnormal s843Tg + MO2-etsrp Fig. 4 with image from Pociute et al., 2019
thoracic duct TagRFP expression absent, abnormal nim5Tg; y1Tg + MO2-etsrp Fig. 3 with image from Davis et al., 2018
thoracic duct EGFP expression absent, abnormal y1Tg + MO2-etsrp Fig. 3 with imageFig. 4 with image from Davis et al., 2018
thoracic duct absent, abnormal nim5Tg; y1Tg + MO2-etsrp Fig. 3 with imageFig. 4 with image from Davis et al., 2018
trunk vasculature morphology, abnormal nim5Tg; y1Tg + MO2-etsrp Fig. 3 with image from Davis et al., 2018
vascular lymphangioblast absent, abnormal ci5Tg; y1Tg + MO2-etsrp Fig. 3 with image from Davis et al., 2018
vascular lymphangioblast EGFP expression absent, abnormal ci5Tg; y1Tg + MO2-etsrp Fig. 3 with image from Davis et al., 2018
vascular lymphangioblast decreased amount, abnormal nim5Tg; nkuasgfp1aTg + MO2-etsrp Fig. 5 with image from Davis et al., 2018
Phenotype of all Fish created by or utilizing MO2-etsrp
Phenotype Fish Conditions Figures
supraintestinal artery Kaede expression decreased amount, abnormal ci49Tg/ci49Tg + MO1-etsrp + MO2-etsrp light intensity Fig. 5 from Metikala et al., 2022
supraintestinal artery decreased amount, abnormal ci49Tg/ci49Tg + MO1-etsrp + MO2-etsrp light intensity Fig. 5 from Metikala et al., 2022
extension tal1 expression decreased amount, abnormal ci49Tg/ci49Tg + MO1-etsrp + MO2-etsrp light intensity Fig. 5 from Metikala et al., 2022
extension inserted into supraintestinal artery, abnormal ci49Tg/ci49Tg + MO1-etsrp + MO2-etsrp light intensity Fig. 5 from Metikala et al., 2022
posterior lateral mesoderm morphology, abnormal AB + MO2-etsrp standard conditions Fig. 4 with image from Liu et al., 2008
embryonic hemopoiesis disrupted, abnormal AB + MO2-etsrp standard conditions Fig. 4 with image from Liu et al., 2008
endothelial cell cdh5 expression absent, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell absent, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myeloid cell differentiation disrupted, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 from Sumanas et al., 2008
posterior caudal vein flt4 expression decreased amount, abnormal WT + MO2-etsrp control Fig. 6 with image from Davis et al., 2018
posterior caudal vein lyve1b expression decreased amount, abnormal WT + MO2-etsrp control Fig. 6 with image from Davis et al., 2018
embryonic blood vessel endothelial progenitor cell kdrl expression decreased amount, abnormal WT + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell cdh5 expression decreased amount, abnormal WT + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
blood vessel morphogenesis disrupted, abnormal WT + MO2-etsrp standard conditions Fig. S2 from Herpers et al., 2008
regulation of myeloid leukocyte differentiation disrupted, abnormal WT + MO2-etsrp standard conditions Fig. 4 from Bukrinsky et al., 2009
blood vasculature morphology, abnormal WT + MO2-etsrp standard conditions Fig. S2 from Herpers et al., 2008
whole organism neoplasm has fewer parts of type blood vessel, abnormal ci5Tg + MO2-etsrp ultraviolet light, cancer xenotransplantation Fig. 7 from Baltrunaite et al., 2017
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal ci6Tg + MO1-etsrp + MO2-etsrp control Fig. 2 from Craig et al., 2015
blood vessel development disrupted, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
dorsal aorta absent, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
intersegmental vessel EGFP expression absent, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
caudal vein plexus EGFP expression decreased amount, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
intersegmental vessel EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp control Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
blood vasculature EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
blood vessel EGFP expression spatial pattern, abnormal s843Tg + MO2-etsrp control Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel EGFP expression spatial pattern, abnormal s843Tg + MO2-etsrp control Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel EGFP expression spatial pattern, abnormal s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
blood vessel EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
blood vasculature EGFP expression spatial pattern, abnormal s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
intersegmental vessel decreased height, abnormal s843Tg + MO2-etsrp control Fig. 7 with image from Chetty et al., 2020
intersegmental vessel irregular spatial pattern, abnormal s843Tg + MO2-etsrp control Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel height, exacerbated s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
sprouting angiogenesis delayed, abnormal s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
angiogenic sprout mislocalised, abnormal s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
intersegmental vessel decreased amount, abnormal s843Tg + MO2-etsrp control Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
blood vasculature structure, abnormal s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
intersegmental vessel amount, exacerbated s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
blood vessel EGFP expression spatial pattern, abnormal s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
blood vessel EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp control Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
blood vasculature EGFP expression decreased distribution, abnormal s843Tg + MO2-etsrp control Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
intersegmental vessel angiogenic sprout decreased length, abnormal s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
intersegmental vessel spatial pattern, exacerbated s843Tg + MO2-etsrp chemical treatment: SL-327 Fig. 7 with image from Chetty et al., 2020
blood vasculature EGFP expression spatial pattern, abnormal s843Tg + MO2-etsrp control Fig. 2 with imageFig. 7 with image from Chetty et al., 2020
vascular endothelium mislocalised, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
dorsal aorta absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
interrenal primordium left side unfused from interrenal primordium right side, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
intersegmental vessel spatial pattern, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
interrenal primordium bilateral, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
posterior cardinal vein absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
vasculogenesis process quality, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
dorsal aorta decreased size, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
axial vasculature apoptotic process increased process quality, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 6 from Craig et al., 2015
endothelial cell EGFP expression absent, abnormal y1Tg + MO2-etsrp control Fig. 5 with image from Chetty et al., 2020
posterior cardinal vein absent, abnormal y1Tg + MO2-etsrp control Fig. 4 with image from Qiu et al., 2016
vasculature EGFP expression increased amount, abnormal y1Tg + MO2-etsrp cancer xenotransplantation Fig. 5 from Baltrunaite et al., 2017
dorsal aorta absent, abnormal y1Tg + MO2-etsrp control Fig. 4 with image from Qiu et al., 2016
whole organism neoplasm lacks all parts of type angiogenic sprout, abnormal y1Tg + MO2-etsrp ultraviolet light, cancer xenotransplantation Fig. 5 from Baltrunaite et al., 2017
whole organism neoplasm decreased size, abnormal y1Tg + MO2-etsrp ultraviolet light, cancer xenotransplantation Fig. 5 from Baltrunaite et al., 2017
whole organism neoplasm EGFP expression decreased amount, abnormal y1Tg + MO2-etsrp ultraviolet light, cancer xenotransplantation Fig. 5 from Baltrunaite et al., 2017
vasculature EGFP expression increased amount, abnormal y1Tg + MO2-etsrp ultraviolet light, cancer xenotransplantation Fig. 5 from Baltrunaite et al., 2017
thoracic duct EGFP expression absent, abnormal y1Tg + MO2-etsrp standard conditions Fig. 4 with image from Davis et al., 2018
thoracic duct absent, abnormal y1Tg + MO2-etsrp standard conditions Fig. 4 with image from Davis et al., 2018
intestine decreased size, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
dorsal aorta absent, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
blood vessel development disrupted, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
vascular lymphangioblast absent, abnormal ci5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
thoracic duct EGFP expression absent, abnormal ci5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
trunk vasculature morphology, abnormal ci5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
lymphangiogenesis decreased occurrence, abnormal ci5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
thoracic duct absent, abnormal ci5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
vascular lymphangioblast EGFP expression absent, abnormal ci5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
intersegmental vessel EGFP expression decreased distribution, abnormal is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
intersegmental vessel EGFP expression spatial pattern, abnormal is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
blood vessel EGFP expression spatial pattern, abnormal is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
blood vessel EGFP expression decreased distribution, abnormal is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
axial blood vessel blood vessel endothelial cell decreased amount, abnormal is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
blood vasculature EGFP expression spatial pattern, abnormal is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
blood vasculature EGFP expression decreased distribution, abnormal is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
vascular lymphangioblast decreased amount, abnormal nim5Tg; nkuasgfp1aTg + MO2-etsrp standard conditions Fig. 5 with image from Davis et al., 2018
thoracic duct TagRFP expression absent, abnormal nim5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
trunk vasculature morphology, abnormal nim5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
thoracic duct absent, abnormal nim5Tg; y1Tg + MO2-etsrp standard conditions Fig. 3 with image from Davis et al., 2018
blood cell decreased amount, abnormal sd2Tg; tsu2013Tg + MO2-etsrp control Fig. 4 with image from Qiu et al., 2016
embryonic blood vessel endothelial progenitor cell cdh5 expression decreased distribution, abnormal clec14aci15/ci15 + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell kdrl expression decreased distribution, abnormal clec14aci15/ci15 + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell cdh5 expression decreased amount, abnormal clec14aci15/ci15 + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
embryonic blood vessel endothelial progenitor cell kdrl expression decreased amount, abnormal clec14aci15/ci15 + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
endothelial cell cdh5 expression absent, abnormal gfi1aaqmc551Gt/qmc551Gt + MO2-etsrp standard conditions Fig. 5 from Moore et al., 2018
erythroid lineage cell alas2 expression amount, ameliorated gfi1aaszy5/szy5 + MO2-etsrp standard conditions FIGURE 4 with image from Wu et al., 2022
endothelial cell kdrl expression amount, ameliorated gfi1aaszy5/szy5 + MO2-etsrp standard conditions FIGURE 4 with image from Wu et al., 2022
erythroid lineage cell alas2 expression amount, ameliorated gfi1aaszy5/szy5 + MO2-etsrp + MO5-sox7 standard conditions FIGURE 4 with image from Wu et al., 2022
endothelial cell kdrl expression amount, ameliorated gfi1aaszy5/szy5 + MO2-etsrp + MO5-sox7 standard conditions FIGURE 4 with image from Wu et al., 2022
endothelial cell cdh5 expression absent, abnormal WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardium fused with myocardium, ameliorated WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell absent, abnormal WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
sprouting angiogenesis delayed, exacerbated clec14aci15/ci15; s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
angiogenic sprout mislocalised, exacerbated clec14aci15/ci15; s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
intersegmental vessel angiogenic sprout decreased length, exacerbated clec14aci15/ci15; s843Tg + MO2-etsrp standard conditions Fig. 4 with image from Pociute et al., 2019
intersegmental vessel EGFP expression decreased distribution, abnormal ets1ci14/ci14; is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
intersegmental vessel EGFP expression spatial pattern, abnormal ets1ci14/ci14; is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
blood vessel EGFP expression spatial pattern, abnormal ets1ci14/ci14; is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
blood vessel EGFP expression decreased distribution, abnormal ets1ci14/ci14; is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
axial blood vessel blood vessel endothelial cell decreased amount, abnormal ets1ci14/ci14; is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
blood vasculature EGFP expression spatial pattern, abnormal ets1ci14/ci14; is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
blood vasculature EGFP expression decreased distribution, abnormal ets1ci14/ci14; is4Tg; s843Tg + MO2-etsrp control Fig. 3 with image from Chetty et al., 2020
intersegmental vessel EGFP expression decreased distribution, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
intersegmental vessel EGFP expression spatial pattern, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
blood vessel EGFP expression spatial pattern, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
blood vasculature structure, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
blood vessel EGFP expression decreased distribution, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
intersegmental vessel irregular spatial pattern, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
blood vasculature EGFP expression spatial pattern, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
intersegmental vessel decreased amount, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
blood vasculature EGFP expression decreased distribution, abnormal ets1ci14/ci14; s843Tg + MO2-etsrp control Fig. 2 with image from Chetty et al., 2020
skeletal muscle cell differentiation increased occurrence, abnormal etsrpci32Gt/+; nkuasgfp1aTg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chestnut et al., 2020
intersegmental vessel sprouting angiogenesis arrested, abnormal fli1rstpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
vasculogenesis process quality, abnormal fli1rstpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal fli1rstpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel sprouting angiogenesis arrested, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature malformed, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature apoptotic process increased process quality, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 6 from Craig et al., 2015
vasculogenesis process quality, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature vasculogenesis process quality, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
whole organism neoplasm EGFP expression decreased amount, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO2-etsrp ultraviolet light, cancer xenotransplantation Fig. 6 from Baltrunaite et al., 2017
whole organism neoplasm lacks all parts of type angiogenic sprout, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO2-etsrp ultraviolet light, cancer xenotransplantation Fig. 6 from Baltrunaite et al., 2017
whole organism neoplasm lacks parts or has fewer parts of type blood vessel, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO2-etsrp ultraviolet light, cancer xenotransplantation Fig. 6 from Baltrunaite et al., 2017
endothelial cell absent, abnormal fb9Tg; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell EGFP expression absent, abnormal fb9Tg; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated fb9Tg; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
Citations