Morpholino

MO5-cyp26b1

ID

ZDB-MRPHLNO-090417-1

Name

MO5-cyp26b1

Previous Names

Target

Sequence

5' - AGCTATTGACATTTTACCTTTCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to splice-donor junction between exon 3 and intron 3

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-cyp26b1

No data available

Phenotype

Phenotype resulting from MO5-cyp26b1

Phenotype	Fish	Figures
basibranchial malformed, abnormal	WT + MO5-cyp26b1	Fig. 4 from Laue et al., 2008
centrum ossified, abnormal	WT + MO5-cyp26b1	Fig. 6 from Laue et al., 2008
ethmoid cartilage decreased size, abnormal	WT + MO5-cyp26b1	Fig. 4 from Laue et al., 2008
ethmoid cartilage malformed, abnormal	WT + MO5-cyp26b1	Fig. 4 from Laue et al., 2008
hyoid muscle tendon formation decreased process quality, abnormal	fb301Tg; pc11Tg + MO5-cyp26b1	Fig. 7 from McGurk et al., 2017
hyosymplectic cartilage composition, abnormal	WT + MO5-cyp26b1	Fig. 5 from Laue et al., 2008
opercle increased size, abnormal	WT + MO5-cyp26b1	Fig. 5 from Laue et al., 2008
parachordal cartilage malformed, abnormal	WT + MO5-cyp26b1	Fig. 4 from Laue et al., 2008
regulation of ossification disrupted, abnormal	WT + MO5-cyp26b1	Fig. 5 , Fig. 6 from Laue et al., 2008

Phenotype of all Fish created by or utilizing MO5-cyp26b1

Phenotype	Fish	Conditions	Figures
parachordal cartilage malformed, abnormal	WT + MO5-cyp26b1	standard conditions	Fig. 4 from Laue et al., 2008
opercle increased size, abnormal	WT + MO5-cyp26b1	standard conditions	Fig. 5 from Laue et al., 2008
ethmoid cartilage decreased size, abnormal	WT + MO5-cyp26b1	standard conditions	Fig. 4 from Laue et al., 2008
hyosymplectic cartilage composition, abnormal	WT + MO5-cyp26b1	standard conditions	Fig. 5 from Laue et al., 2008
ethmoid cartilage malformed, abnormal	WT + MO5-cyp26b1	standard conditions	Fig. 4 from Laue et al., 2008
centrum ossified, abnormal	WT + MO5-cyp26b1	standard conditions	Fig. 6 from Laue et al., 2008
basibranchial malformed, abnormal	WT + MO5-cyp26b1	standard conditions	Fig. 4 from Laue et al., 2008
regulation of ossification disrupted, abnormal	WT + MO5-cyp26b1	standard conditions	Fig. 5 , Fig. 6 from Laue et al., 2008
hyoid muscle tendon formation decreased process quality, abnormal	fb301Tg; pc11Tg + MO5-cyp26b1	standard conditions	Fig. 7 from McGurk et al., 2017

Citations