Morpholino

MO2-ulk2

ID

ZDB-MRPHLNO-110825-3

Name

MO2-ulk2

Previous Names

ulk2 MO spl (1)

Target

ulk2 (1)

Sequence

5' - TCGGCTGTTAAACAAAGAGAGCGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocker targeted to to a splice acceptor site at the beginning of exon 7, resulting in deletion of exon 7 and a frameshift-induced stop codon in exon 8.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ulk2

Expressed Gene	Anatomy	Figures
kctd12.1	dorsal habenular nucleus (not) habenula	Fig. 9 from Taylor et al., 2011

Phenotype

Phenotype resulting from MO2-ulk2

Phenotype	Fish	Figures
dendrite morphogenesis disrupted, abnormal	WT + MO2-ulk2	Fig. 6 from Colombo et al., 2013
dorsal habenular nucleus dendrite decreased volume, abnormal	AB + MO2-ulk2	Fig. 9 from Taylor et al., 2011
habenula dendrite absent, abnormal	AB + MO2-ulk2	Fig. 4 from Taylor et al., 2011
habenula dendrite decreased branchiness, abnormal	s1019tEt + MO2-ulk2	Fig. 2 from Lee et al., 2014
habenula dendrite decreased volume, abnormal	AB + MO2-ulk2	Fig. 6 from Colombo et al., 2013 Fig. 4 from Taylor et al., 2011
habenula dendrite arborization process quality, abnormal	s1019tEt + MO2-ulk2	Fig. 3 from Lee et al., 2014
habenula development disrupted, abnormal	WT + MO2-ulk2	Fig. 6 from Colombo et al., 2013
habenula development process quality, abnormal	AB + MO2-ulk2	Fig. 4, Fig. 9 from Taylor et al., 2011
regulation of dendrite morphogenesis process quality, abnormal	AB + MO2-ulk2	Fig. 4, Fig. 9 from Taylor et al., 2011
ventral habenular nucleus dendrite decreased volume, abnormal	AB + MO2-ulk2	Fig. 9 from Taylor et al., 2011

Phenotype of all Fish created by or utilizing MO2-ulk2

Phenotype	Fish	Conditions	Figures
dorsal habenular nucleus dendrite decreased volume, abnormal	AB + MO2-ulk2	standard conditions	Fig. 9 from Taylor et al., 2011
habenula dendrite decreased volume, abnormal	AB + MO2-ulk2	standard conditions	Fig. 4 from Taylor et al., 2011
regulation of dendrite morphogenesis process quality, abnormal	AB + MO2-ulk2	standard conditions	Fig. 4, Fig. 9 from Taylor et al., 2011
habenula development process quality, abnormal	AB + MO2-ulk2	standard conditions	Fig. 4, Fig. 9 from Taylor et al., 2011
habenula dendrite absent, abnormal	AB + MO2-ulk2	standard conditions	Fig. 4 from Taylor et al., 2011
ventral habenular nucleus dendrite decreased volume, abnormal	AB + MO2-ulk2	standard conditions	Fig. 9 from Taylor et al., 2011
habenula development disrupted, abnormal	WT + MO2-ulk2	standard conditions	Fig. 6 from Colombo et al., 2013
habenula dendrite decreased volume, abnormal	WT + MO2-ulk2	standard conditions	Fig. 6 from Colombo et al., 2013
dendrite morphogenesis disrupted, abnormal	WT + MO2-ulk2	standard conditions	Fig. 6 from Colombo et al., 2013
habenula dendrite arborization process quality, abnormal	s1019tEt + MO2-ulk2	control	Fig. 3 from Lee et al., 2014
habenula dendrite decreased branchiness, abnormal	s1019tEt + MO2-ulk2	control	Fig. 2 from Lee et al., 2014
habenula development disrupted, abnormal	WT + MO2-daam1a + MO2-ulk2	standard conditions	Fig. 6 from Colombo et al., 2013
dendrite morphogenesis disrupted, abnormal	WT + MO2-daam1a + MO2-ulk2	standard conditions	Fig. 6 from Colombo et al., 2013
habenula dendrite decreased volume, abnormal	WT + MO2-daam1a + MO2-ulk2	standard conditions	Fig. 6 from Colombo et al., 2013
dorsal habenular nucleus dendrite decreased volume, abnormal	kctd12.1^{vu442Tg/vu442Tg} + MO2-ulk2 (AB)	standard conditions	Fig. 9 from Taylor et al., 2011
regulation of dendrite morphogenesis process quality, abnormal	kctd12.1^{vu442Tg/vu442Tg} + MO2-ulk2 (AB)	standard conditions	Fig. 9 from Taylor et al., 2011
habenula development process quality, abnormal	kctd12.1^{vu442Tg/vu442Tg} + MO2-ulk2 (AB)	standard conditions	Fig. 9 from Taylor et al., 2011

Citations