Morpholino

MO1-s1pr2

ID
ZDB-MRPHLNO-070911-3
Name
MO1-s1pr2
Previous Names
  • mil-MO (1)
  • MO1-edg5
Target
Sequence
5' - CCGCAAACAGACGGCAAGTAGTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-s1pr2
Phenotype
Phenotype resulting from MO1-s1pr2
Phenotype Fish Figures
anterior lateral line neuromast hair cell decreased amount, abnormal WT + MO1-s1pr2 Fig. 3 from Hu et al., 2013
anterior lateral line neuromast hair cell development disrupted, abnormal WT + MO1-s1pr2 Fig. 3 from Hu et al., 2013
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-s1pr2 Fig. 1 with imageFig. 2 with imageFig. 3 with image from Fukui et al., 2014
cardioblast migration to the midline involved in heart rudiment formation decreased process quality, abnormal ko07Tg + MO1-s1pr2 Fig. S1 with image from Hisano et al., 2013
cardioblast migration to the midline involved in heart rudiment formation disrupted, abnormal ko07Tg + MO1-s1pr2 Fig. S1 with image from Hisano et al., 2013
caudal fin blistered, abnormal WT + MO1-s1pr2 Fig. 1 with image from Ye et al., 2013
Fig. S4 from Kawahara et al., 2009
cell migration involved in gastrulation disrupted, abnormal WT + MO1-s1pr2 Fig. 1 with imageFig. S3 with image from Kai et al., 2008
embryonic heart tube morphogenesis disrupted, abnormal AB/TU + MO1-s1pr2 Fig. 3 from Nakanaga et al., 2014
endocardium mislocalised, abnormal is5Tg; ui6Tg + MO1-s1pr2 Fig. 1 with image from Xie et al., 2016
endoderm anterior region apoptotic, abnormal ha01Tg + MO1-s1pr2 Fig. 3 with image from Fukui et al., 2014
endoderm anterior region increased width, abnormal ha01Tg; twu34Tg + MO1-s1pr2 Fig. 7 with image from Ye et al., 2013
endoderm anterior region perforate, abnormal ha01Tg; twu34Tg + MO1-s1pr2 Fig. 7 with image from Ye et al., 2013
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-s1pr2 Fig. 2 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal ha01Tg + MO1-s1pr2 Fig. 3 with image from Fukui et al., 2014
epidermal cell aggregated, abnormal WT + MO1-s1pr2 Fig. 7 with image from Gu et al., 2015
heart bifurcated, abnormal ko07Tg + MO1-s1pr2 Fig. S4Fig. S11 from Kawahara et al., 2009
heart duplicated, abnormal ha01Tg; twu34Tg + MO1-s1pr2 Fig. 1 with imageFig. 2 with imageFig. 7 with image from Ye et al., 2013
heart malformed, abnormal ncv10Tg + MO1-s1pr2 Fig. 1 with image from Fukui et al., 2014
heart split bilaterally, abnormal ncv10Tg + MO1-s1pr2 Fig. 1 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ncv10Tg + MO1-s1pr2 Fig. 1 with imageFig. 2 with imageFig. 3 with image from Fukui et al., 2014
heart tube bifurcated, abnormal WT + MO1-s1pr2 Fig. S3 with image from Hisano et al., 2013
heart tube increased amount, abnormal ko07Tg + MO1-s1pr2 Fig. S1 with image from Hisano et al., 2013
heart tube mislocalised laterally, abnormal ko07Tg + MO1-s1pr2 Fig. S1 with image from Hisano et al., 2013
heart tube split bilaterally, abnormal ha01Tg + MO1-s1pr2 Fig. 1 with imageFig. 2 with imageFig. 3 with image from Fukui et al., 2014
hypoblast mesodermal cell spatial pattern, abnormal WT + MO1-s1pr2 Fig. S4 with image from Kai et al., 2008
mesodermal cell migration increased rate, abnormal WT + MO1-s1pr2 Fig. 1 with image from Kai et al., 2008
myocardial precursor mislocalised laterally, abnormal AB + MO1-s1pr2 Fig. 1 with imageFig. 2 with image from Fukui et al., 2014
neural keel increased length, abnormal WT + MO1-s1pr2 Fig. S3 with image from Kai et al., 2008
neuromast hair cell apoptotic, abnormal WT + MO1-s1pr2 Fig. 5 from Hu et al., 2013
otic vesicle morphogenesis disrupted, abnormal WT + MO1-s1pr2 Fig. 2 from Hu et al., 2013
otolith increased size, abnormal WT + MO1-s1pr2 Fig. 2 from Hu et al., 2013
otolith malformed, abnormal WT + MO1-s1pr2 Fig. 2 from Hu et al., 2013
pericardium edematous, abnormal WT + MO1-s1pr2 Fig. 1 with image from Ye et al., 2013
pharyngeal arch 1 decreased length, abnormal WT + MO1-s1pr2 Fig. S1 with image from Hisano et al., 2013
pharyngeal arch 1 morphology, abnormal WT + MO1-s1pr2 Fig. S1 with image from Hisano et al., 2013
pharyngeal endoderm mislocalised laterally, abnormal AB + MO1-s1pr2 Fig. 2 with image from Fukui et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal WT + MO1-s1pr2 Fig. 3 from Hu et al., 2013
posterior lateral line neuromast decreased size, abnormal WT + MO1-s1pr2 Fig. 3 from Hu et al., 2013
posterior lateral line neuromast hair cell development disrupted, abnormal WT + MO1-s1pr2 Fig. 3 from Hu et al., 2013
prechordal plate flat, abnormal WT + MO1-s1pr2 Fig. 1 with image from Kai et al., 2008
prechordal plate increased length, abnormal WT + MO1-s1pr2 Fig. 1 with image from Kai et al., 2008
prechordal plate increased width, abnormal WT + MO1-s1pr2 Fig. 1 with image from Kai et al., 2008
saccule decreased size, abnormal WT + MO1-s1pr2 Fig. 2 from Hu et al., 2013
semicircular canal broken into two pieces, abnormal WT + MO1-s1pr2 Fig. 2 from Hu et al., 2013
semicircular canal morphology, abnormal WT + MO1-s1pr2 Fig. 2 from Hu et al., 2013
semicircular canal development disrupted, abnormal WT + MO1-s1pr2 Fig. 2 from Hu et al., 2013
utricle increased size, abnormal WT + MO1-s1pr2 Fig. 2 from Hu et al., 2013
Phenotype of all Fish created by or utilizing MO1-s1pr2
Phenotype Fish Conditions Figures
pharyngeal endoderm mislocalised laterally, abnormal AB + MO1-s1pr2 standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal AB + MO1-s1pr2 standard conditions Fig. 1 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal AB + MO1-s1pr2 standard conditions Fig. 1 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal AB + MO1-s1pr2 standard conditions Fig. 1 with image from Fukui et al., 2014
embryonic heart tube morphogenesis disrupted, abnormal AB/TU + MO1-s1pr2 standard conditions Fig. 3 from Nakanaga et al., 2014
prechordal plate increased width, abnormal WT + MO1-s1pr2 standard conditions Fig. 1 with image from Kai et al., 2008
pericardium edematous, abnormal WT + MO1-s1pr2 standard conditions Fig. 1 with image from Ye et al., 2013
heart bifurcated, abnormal WT + MO1-s1pr2 standard conditions Fig. S4Fig. S11 from Kawahara et al., 2009
epidermal cell cell aggregation decreased amount, abnormal WT + MO1-s1pr2 chemical treatment: EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor Fig. 7 with image from Gu et al., 2015
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal WT + MO1-s1pr2 standard conditions Fig. 3 from Hu et al., 2013
semicircular canal broken into two pieces, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 from Hu et al., 2013
hypoblast mesodermal cell spatial pattern, abnormal WT + MO1-s1pr2 standard conditions Fig. S4 with image from Kai et al., 2008
utricle increased size, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 from Hu et al., 2013
neuromast hair cell apoptotic, abnormal WT + MO1-s1pr2 standard conditions Fig. 5 from Hu et al., 2013
pharyngeal arch 1 morphology, abnormal WT + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
heart tube bifurcated, abnormal WT + MO1-s1pr2 standard conditions Fig. S3 with image from Hisano et al., 2013
posterior lateral line neuromast hair cell development disrupted, abnormal WT + MO1-s1pr2 standard conditions Fig. 3 from Hu et al., 2013
heart duplicated, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 with image from Ye et al., 2013
semicircular canal development disrupted, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 from Hu et al., 2013
anterior lateral line neuromast hair cell development disrupted, abnormal WT + MO1-s1pr2 standard conditions Fig. 3 from Hu et al., 2013
posterior lateral line neuromast decreased size, abnormal WT + MO1-s1pr2 standard conditions Fig. 3 from Hu et al., 2013
cell migration involved in gastrulation disrupted, abnormal WT + MO1-s1pr2 standard conditions Fig. 1 with imageFig. S3 with image from Kai et al., 2008
pharyngeal arch 1 decreased length, abnormal WT + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
epidermal cell aggregated, abnormal WT + MO1-s1pr2 control Fig. 7 with image from Gu et al., 2015
semicircular canal morphology, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 from Hu et al., 2013
prechordal plate flat, abnormal WT + MO1-s1pr2 standard conditions Fig. 1 with image from Kai et al., 2008
otic vesicle morphogenesis disrupted, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 from Hu et al., 2013
caudal fin blistered, abnormal WT + MO1-s1pr2 standard conditions Fig. 1 with image from Ye et al., 2013
Fig. S4 from Kawahara et al., 2009
otolith malformed, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 from Hu et al., 2013
anterior lateral line neuromast hair cell decreased amount, abnormal WT + MO1-s1pr2 standard conditions Fig. 3 from Hu et al., 2013
mesodermal cell migration increased rate, abnormal WT + MO1-s1pr2 standard conditions Fig. 1 with image from Kai et al., 2008
neural keel increased length, abnormal WT + MO1-s1pr2 standard conditions Fig. S3 with image from Kai et al., 2008
otolith increased size, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 from Hu et al., 2013
saccule decreased size, abnormal WT + MO1-s1pr2 standard conditions Fig. 2 from Hu et al., 2013
prechordal plate increased length, abnormal WT + MO1-s1pr2 standard conditions Fig. 1 with image from Kai et al., 2008
heart tube split bilaterally, abnormal ha01Tg + MO1-s1pr2 standard conditions Fig. 3 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg + MO1-s1pr2 standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal ha01Tg + MO1-s1pr2 standard conditions Fig. 3 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg + MO1-s1pr2 standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal ha01Tg + MO1-s1pr2 standard conditions Fig. 3 with image from Fukui et al., 2014
heart tube increased amount, abnormal ko07Tg + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
heart tube mislocalised laterally, abnormal ko07Tg + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
heart bifurcated, abnormal ko07Tg + MO1-s1pr2 standard conditions Fig. S4 from Kawahara et al., 2009
cardioblast migration to the midline involved in heart rudiment formation disrupted, abnormal ko07Tg + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
cardioblast migration to the midline involved in heart rudiment formation decreased process quality, abnormal ko07Tg + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
heart split bilaterally, abnormal ncv10Tg + MO1-s1pr2 standard conditions Fig. 1 with image from Fukui et al., 2014
heart malformed, abnormal ncv10Tg + MO1-s1pr2 standard conditions Fig. 1 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ncv10Tg + MO1-s1pr2 standard conditions Fig. 1 with image from Fukui et al., 2014
heart duplicated, abnormal twu34Tg + MO1-s1pr2 standard conditions Fig. 1 with image from Ye et al., 2013
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-s1pr2 standard conditions Fig. 2 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-s1pr2 standard conditions Fig. 2 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-s1pr2 standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-s1pr2 standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-s1pr2 standard conditions Fig. 2 with image from Fukui et al., 2014
heart duplicated, abnormal ha01Tg; twu34Tg + MO1-s1pr2 standard conditions Fig. 7 with image from Ye et al., 2013
endoderm anterior region perforate, abnormal ha01Tg; twu34Tg + MO1-s1pr2 standard conditions Fig. 7 with image from Ye et al., 2013
endoderm anterior region increased width, abnormal ha01Tg; twu34Tg + MO1-s1pr2 standard conditions Fig. 7 with image from Ye et al., 2013
endocardium mislocalised, abnormal is5Tg; ui6Tg + MO1-s1pr2 standard conditions Fig. 1 with image from Xie et al., 2016
pharyngeal arch 1 decreased length, abnormal fn1akt259/kt259 + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
pharyngeal arch 1 morphology, abnormal fn1akt259/kt259 + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
heart bifurcated, abnormal spns2ko157/ko157 + MO1-s1pr2 standard conditions Fig. S11 from Kawahara et al., 2009
involution involved in gastrulation with mouth forming second disrupted, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 4 with image from Kai et al., 2008
mesodermal cell lamellipodium increased length, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 3 with image from Kai et al., 2008
mesodermal cell migration process quality, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 3 with image from Kai et al., 2008
hypoblast mesodermal cell cellular motility, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 2 with image from Kai et al., 2008
notochord decreased length, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 1 with image from Kai et al., 2008
hypoblast mesodermal cell spatial pattern, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 2 with image from Kai et al., 2008
notochord increased thickness, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 1 with image from Kai et al., 2008
hypoblast mesodermal cell increased speed, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 2 with image from Kai et al., 2008
cell migration involved in gastrulation disrupted, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 2 with image from Kai et al., 2008
convergent extension involved in gastrulation disrupted, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 1 with image from Kai et al., 2008
prechordal plate increased length, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 1 with image from Kai et al., 2008
mesodermal cell migration persistence, abnormal wnt11f2tx226/tx226 + MO1-s1pr2 standard conditions Fig. 2 with image from Kai et al., 2008
intersegmental vessel shortened, abnormal y1Tg + MO1-s1pr2 + MO2-s1pr1 standard conditions Fig. 7 from Mendelson et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO1-s1pr2 + MO2-s1pr1 standard conditions Fig. 7 from Mendelson et al., 2013
heart tube increased amount, abnormal fn1akt259/kt259; ko07Tg + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
cardioblast migration to the midline involved in heart rudiment formation absent, abnormal fn1akt259/kt259; ko07Tg + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
heart tube mislocalised laterally, abnormal fn1akt259/kt259; ko07Tg + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
cardioblast migration to the midline involved in heart rudiment formation disrupted, abnormal fn1akt259/kt259; ko07Tg + MO1-s1pr2 standard conditions Fig. S1 with image from Hisano et al., 2013
heart bifurcated, abnormal spns2ko157/+; ko07Tg + MO1-s1pr2 standard conditions Fig. 2 from Kawahara et al., 2009
Citations