Morpholino

MO2-spaw

ID
ZDB-MRPHLNO-060112-2
Name
MO2-spaw
Previous Names
None
Target
Sequence
5' - TGGTAGAGCTTCAACAGACTCTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The authors indicate that this MO binds the last intron-exon boundary. In addition, this sequence also appears to be complementary to a portion of the mRNA containing both exons (AY24007).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-spaw
Expressed Gene Anatomy Figures
kctd12.1 Fig. 2 from Kuan et al., 2007
Fig. S3 with image from Gamse et al., 2005
noto Fig. 7 with image from Long et al., 2003
nrp1a Fig. 2 with image from Kuan et al., 2007
otx5 Fig. 2 with image from Kuan et al., 2007
prrx1a Fig. 4 from Ocaña et al., 2017
Phenotype
Phenotype resulting from MO2-spaw
Phenotype Fish Figures
determination of left/right symmetry disrupted, abnormal zf15Tg + MO2-spaw Fig. 2 from Kuan et al., 2007
Fig. S3 with image from Gamse et al., 2005
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-spaw Fig. S3 with image from Gamse et al., 2005
fasciculus retroflexus axon misrouted, abnormal zf15Tg + MO2-spaw Fig. 2 from Kuan et al., 2007
habenula symmetry, abnormal WT + MO2-spaw Fig. S3 with image from Gamse et al., 2005
heart morphogenesis process quality, abnormal twu34Tg + MO2-spaw Fig. 2 from Rohr et al., 2008
heart rudiment bilateral symmetry, abnormal twu34Tg + MO2-spaw Fig. 2 from Rohr et al., 2008
lateral plate mesoderm prrx1a expression spatial pattern, abnormal AB + MO2-spaw Fig. 4 from Ocaña et al., 2017
pancreas symmetry, abnormal WT + MO2-spaw Fig. S3 with image from Gamse et al., 2005
parapineal organ position, abnormal zf15Tg + MO2-spaw Fig. 2 from Kuan et al., 2007
Phenotype of all Fish created by or utilizing MO2-spaw
Phenotype Fish Conditions Figures
lateral plate mesoderm prrx1a expression spatial pattern, abnormal AB + MO2-spaw standard conditions Fig. 4 from Ocaña et al., 2017
determination of left/right symmetry disrupted, abnormal WT + MO1-spaw + MO2-spaw standard conditions Fig. 3 with image from Smith et al., 2008
heart looping disrupted, abnormal WT + MO1-spaw + MO2-spaw standard conditions Fig. 3 with image from Smith et al., 2008
pancreas symmetry, abnormal WT + MO2-spaw standard conditions Fig. S3 with image from Gamse et al., 2005
habenula symmetry, abnormal WT + MO2-spaw standard conditions Fig. S3 with image from Gamse et al., 2005
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-spaw standard conditions Fig. S3 with image from Gamse et al., 2005
determination of left/right symmetry disrupted, abnormal WT + MO2-spaw standard conditions Fig. S3 with image from Gamse et al., 2005
heart rudiment bilateral symmetry, abnormal twu34Tg + MO2-spaw standard conditions Fig. 2 from Rohr et al., 2008
heart morphogenesis process quality, abnormal twu34Tg + MO2-spaw standard conditions Fig. 2 from Rohr et al., 2008
determination of left/right symmetry disrupted, abnormal zf15Tg + MO2-spaw standard conditions Fig. 2 from Kuan et al., 2007
parapineal organ position, abnormal zf15Tg + MO2-spaw standard conditions Fig. 2 from Kuan et al., 2007
fasciculus retroflexus axon misrouted, abnormal zf15Tg + MO2-spaw standard conditions Fig. 2 from Kuan et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.