Morpholino

MO3-nipblb

ID
ZDB-MRPHLNO-131219-3
Name
MO3-nipblb
Previous Names
None
Target
Sequence
5' - GTCCCCATTCATGCTGAAGAAGGGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nipblb
Expressed Gene Anatomy Figures
axin2 Fig. 3 from Mazzola et al., 2019
Fig. 4 from Pistocchi et al., 2013
ccnd1 Fig. 6 from Fazio et al., 2016
Fig. 5 from Pistocchi et al., 2013
gata1a FIGURE 3 with image from Mazzola et al., 2020
runx1 FIGURE 2 with image from Mazzola et al., 2020
spi1b FIGURE 3 with image from Mazzola et al., 2020
Fig. 5 from Mazzola et al., 2019
wnt1 Fig. 4 from Pistocchi et al., 2013
Phenotype
Phenotype resulting from MO3-nipblb
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO3-nipblb Fig. 3 from Pistocchi et al., 2013
brain decreased size, abnormal AB + MO3-nipblb Fig. 2 from Pistocchi et al., 2013
caudal hematopoietic tissue GFP expression increased amount, abnormal w25Tg + MO3-nipblb Fig. 3 from Mazzola et al., 2019
caudal hematopoietic tissue spi1b expression increased amount, abnormal AB + MO3-nipblb Fig. 5 from Mazzola et al., 2019
caudal hematopoietic tissue canonical Wnt signaling pathway increased occurrence, abnormal w25Tg + MO3-nipblb Fig. 3 from Mazzola et al., 2019
caudal hematopoietic tissue common myeloid progenitor increased amount, abnormal la2Tg + MO3-nipblb Fig. 2,  Fig. 5 from Mazzola et al., 2019
caudal hematopoietic tissue neutrophil decreased amount, abnormal AB + MO3-nipblb Fig. 2 from Mazzola et al., 2019
cell population proliferation disrupted, abnormal AB + MO3-nipblb Fig. 4 from Fazio et al., 2016
central nervous system development disrupted, abnormal AB + MO3-nipblb Fig. 5 from Pistocchi et al., 2013
eye decreased size, abnormal AB + MO3-nipblb Fig. 2 from Pistocchi et al., 2013
hematopoietic stem cell canonical Wnt signaling pathway increased occurrence, abnormal la2Tg + MO3-nipblb Fig. 4 from Mazzola et al., 2019
neural tube apoptotic, abnormal AB + MO3-nipblb Fig. 3 from Pistocchi et al., 2013
neural tube apoptotic process increased occurrence, abnormal AB + MO3-nipblb Fig. 4 from Fazio et al., 2016
nucleate erythrocyte decreased amount, abnormal AB + MO3-nipblb FIGURE 3 with image from Mazzola et al., 2020
post-vent region curved, abnormal AB + MO3-nipblb Fig. 2 from Pistocchi et al., 2013
post-vent region decreased length, abnormal AB + MO3-nipblb Fig. 2 from Pistocchi et al., 2013
regulation of canonical Wnt signaling pathway disrupted, abnormal AB + MO3-nipblb Fig. 5 from Pistocchi et al., 2013
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO3-nipblb FIGURE 2 with image from Mazzola et al., 2020
whole organism gata1a expression decreased amount, abnormal AB + MO3-nipblb FIGURE 3 with image from Mazzola et al., 2020
whole organism ccnd1 expression decreased amount, abnormal AB + MO3-nipblb Fig. 6 from Fazio et al., 2016
whole organism spi1b expression increased amount, abnormal AB + MO3-nipblb FIGURE 3 with image from Mazzola et al., 2020
whole organism axin2 expression increased amount, abnormal AB + MO3-nipblb Fig. 3 from Mazzola et al., 2019
Phenotype of all Fish created by or utilizing MO3-nipblb
Phenotype Fish Conditions Figures
whole organism spi1b expression increased amount, abnormal AB + MO3-nipblb standard conditions FIGURE 3 with image from Mazzola et al., 2020
caudal hematopoietic tissue spi1b expression increased amount, abnormal AB + MO3-nipblb control Fig. 5 from Mazzola et al., 2019
neural tube apoptotic, abnormal AB + MO3-nipblb standard conditions Fig. 3 from Pistocchi et al., 2013
central nervous system development disrupted, abnormal AB + MO3-nipblb standard conditions Fig. 5 from Pistocchi et al., 2013
nucleate erythrocyte decreased amount, abnormal AB + MO3-nipblb standard conditions FIGURE 3 with image from Mazzola et al., 2020
caudal hematopoietic tissue neutrophil decreased amount, abnormal AB + MO3-nipblb control Fig. 2 from Mazzola et al., 2019
regulation of canonical Wnt signaling pathway disrupted, abnormal AB + MO3-nipblb standard conditions Fig. 5 from Pistocchi et al., 2013
post-vent region decreased length, abnormal AB + MO3-nipblb standard conditions Fig. 2 from Pistocchi et al., 2013
brain decreased size, abnormal AB + MO3-nipblb standard conditions Fig. 2 from Pistocchi et al., 2013
post-vent region curved, abnormal AB + MO3-nipblb standard conditions Fig. 2 from Pistocchi et al., 2013
caudal hematopoietic tissue common myeloid progenitor increased amount, abnormal AB + MO3-nipblb control Fig. 2,  Fig. 5 from Mazzola et al., 2019
whole organism gata1a expression decreased amount, abnormal AB + MO3-nipblb standard conditions FIGURE 3 with image from Mazzola et al., 2020
caudal hematopoietic tissue common myeloid progenitor amount, ameliorated AB + MO3-nipblb chemical treatment by environment: indometacin Fig. 5 from Mazzola et al., 2019
neural tube apoptotic process increased occurrence, abnormal AB + MO3-nipblb standard conditions Fig. 4 from Fazio et al., 2016
apoptotic process increased occurrence, abnormal AB + MO3-nipblb standard conditions Fig. 3 from Pistocchi et al., 2013
whole organism ccnd1 expression decreased amount, abnormal AB + MO3-nipblb standard conditions Fig. 6 from Fazio et al., 2016
whole organism axin2 expression increased amount, abnormal AB + MO3-nipblb control Fig. 3 from Mazzola et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO3-nipblb standard conditions FIGURE 2 with image from Mazzola et al., 2020
eye decreased size, abnormal AB + MO3-nipblb standard conditions Fig. 2 from Pistocchi et al., 2013
caudal hematopoietic tissue spi1b expression amount, ameliorated AB + MO3-nipblb chemical treatment by environment: indometacin Fig. 5 from Mazzola et al., 2019
cell population proliferation disrupted, abnormal AB + MO3-nipblb standard conditions Fig. 4 from Fazio et al., 2016
caudal hematopoietic tissue common myeloid progenitor increased amount, abnormal la2Tg + MO3-nipblb control Fig. 2 from Mazzola et al., 2019
hematopoietic stem cell canonical Wnt signaling pathway increased occurrence, abnormal la2Tg + MO3-nipblb control Fig. 4 from Mazzola et al., 2019
caudal hematopoietic tissue canonical Wnt signaling pathway increased occurrence, abnormal w25Tg + MO3-nipblb control Fig. 3 from Mazzola et al., 2019
caudal hematopoietic tissue GFP expression increased amount, abnormal w25Tg + MO3-nipblb control Fig. 3 from Mazzola et al., 2019
developmental growth arrested, abnormal AB + MO1-smc1a + MO3-nipblb standard conditions Fig. 6 from Fazio et al., 2016
embryo development delayed, abnormal AB + MO1-smc1a + MO3-nipblb standard conditions Fig. 6 from Fazio et al., 2016
whole organism dead, abnormal AB + MO1-smc1a + MO3-nipblb standard conditions Fig. 6 from Fazio et al., 2016
whole organism ccnd1 expression decreased amount, abnormal WT + MO1-smc1a + MO3-nipblb standard conditions Fig. 6 from Fazio et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.