Morpholino

MO1-dnm2a

ID
ZDB-MRPHLNO-070713-2
Name
MO1-dnm2a
Previous Names
  • MO1-dnm2
Target
Sequence
5' - ATTCCTCCATCCCCCGGTTGCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a corrected sequence for the zDnm1 morpholino in Kida et al., 2007.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnm2a
Expressed Gene Anatomy Figures
myod1 Fig. 3 with image from Kida et al., 2007
tbxta Fig. S9 with image from Kida et al., 2007
Phenotype
Phenotype resulting from MO1-dnm2a
Phenotype Fish Figures
cardiac muscle cell chromatin located in cardiac muscle cell nuclear membrane, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
cardiac muscle cell mitochondrion vacuolated, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
heart apoptotic, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
heart decreased functionality, abnormal WT + MO1-dnm2a Fig. 2,  Fig. 7 from Li et al., 2013
heart sarcolemma edematous, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
heart Z disc blurry, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
heart contraction process quality, abnormal WT + MO1-dnm2a Fig. 2,  Fig. 7 from Li et al., 2013
intersegmental vessel increased branchiness, abnormal s843Tg + MO1-dnm2a Fig. 3 from Koutsopoulos et al., 2013
intersegmental vessel sprouting angiogenesis process quality, abnormal s843Tg + MO1-dnm2a Fig. 3 from Koutsopoulos et al., 2013
muscle cell development disrupted, abnormal AB + MO1-dnm2a Fig. 3 from Koutsopoulos et al., 2013
myocardium degenerate, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
notochord bent, abnormal WT + MO1-dnm2a Fig. 3 with image from Kida et al., 2007
notochord decreased length, abnormal WT + MO1-dnm2a Fig. 3 with image from Kida et al., 2007
post-vent region bent, abnormal AB + MO1-dnm2a Fig. S5 from Koutsopoulos et al., 2013
post-vent region myofibril disorganized, abnormal AB + MO1-dnm2a Fig. 3 from Koutsopoulos et al., 2013
presumptive mesoderm decreased length, abnormal WT + MO1-dnm2a Fig. S9 with image from Kida et al., 2007
somite condensed, abnormal WT + MO1-dnm2a Fig. 3 with image,  Fig. S9 with image from Kida et al., 2007
whole organism dead, abnormal AB + MO1-dnm2a Fig. S5 from Koutsopoulos et al., 2013
whole organism decreased length, abnormal WT + MO1-dnm2a Fig. 3 with image,  Fig. S9 with image from Kida et al., 2007
Phenotype of all Fish created by or utilizing MO1-dnm2a
Phenotype Fish Conditions Figures
whole organism dead, abnormal AB + MO1-dnm2a standard conditions Fig. S5 from Koutsopoulos et al., 2013
muscle cell development disrupted, abnormal AB + MO1-dnm2a standard conditions Fig. 3 from Koutsopoulos et al., 2013
post-vent region myofibril disorganized, abnormal AB + MO1-dnm2a standard conditions Fig. 3 from Koutsopoulos et al., 2013
post-vent region bent, abnormal AB + MO1-dnm2a standard conditions Fig. S5 from Koutsopoulos et al., 2013
somite condensed, abnormal WT + MO1-dnm2a standard conditions Fig. 3 with image,  Fig. S9 with image from Kida et al., 2007
whole organism decreased length, abnormal WT + MO1-dnm2a standard conditions Fig. 3 with image,  Fig. S9 with image from Kida et al., 2007
heart Z disc blurry, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
cardiac muscle cell mitochondrion vacuolated, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
heart apoptotic, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
heart contraction process quality, abnormal WT + MO1-dnm2a standard conditions Fig. 2,  Fig. 7 from Li et al., 2013
notochord bent, abnormal WT + MO1-dnm2a standard conditions Fig. 3 with image from Kida et al., 2007
presumptive mesoderm decreased length, abnormal WT + MO1-dnm2a standard conditions Fig. S9 with image from Kida et al., 2007
heart sarcolemma edematous, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
myocardium degenerate, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
cardiac muscle cell chromatin located in cardiac muscle cell nuclear membrane, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
notochord decreased length, abnormal WT + MO1-dnm2a standard conditions Fig. 3 with image from Kida et al., 2007
heart decreased functionality, abnormal WT + MO1-dnm2a standard conditions Fig. 2,  Fig. 7 from Li et al., 2013
intersegmental vessel increased branchiness, abnormal s843Tg + MO1-dnm2a standard conditions Fig. 3 from Koutsopoulos et al., 2013
intersegmental vessel sprouting angiogenesis process quality, abnormal s843Tg + MO1-dnm2a standard conditions Fig. 3 from Koutsopoulos et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.