Morpholino

MO1-reck

ID

ZDB-MRPHLNO-120319-9

Name

MO1-reck

Previous Names

reck exon 7-intron 7 (1)

Target

reck (1)

Sequence

5' - CAGGTAGCAGCCGTCACTCACTCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-reck

Expressed Gene	Anatomy	Figures
elavl1a	(not) dorsal root ganglion	Fig. 3 from Prendergast et al., 2012
reck	(not) whole organism	Fig. 3 from Prendergast et al., 2012

Phenotype

Phenotype resulting from MO1-reck

Phenotype	Fish	Figures
brain vasculature absent, abnormal	s843Tg + MO1-reck	Fig. 2 from Vanhollebeke et al., 2015
central artery absent, abnormal	s843Tg + MO1-reck	Fig. 2 from Vanhollebeke et al., 2015
dorsal root ganglion Wnt signaling pathway decreased process quality, abnormal	ia4Tg; vu234Tg + MO1-reck	Fig. 3 from Vanhollebeke et al., 2015
head hemorrhagic, abnormal	y1Tg + MO1-reck	Fig. 5 from Prendergast et al., 2012
hindbrain central artery absent, abnormal	ia4Tg; s896Tg + MO1-reck	Fig. 2 , Fig. 3 from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal	ia4Tg; s896Tg + MO1-reck	Fig. 3 from Vanhollebeke et al., 2015
neural crest cell migration decreased rate, abnormal	w18Tg; w69Tg + MO1-reck	Fig. 7 from Prendergast et al., 2012
neural crest cell migration increased rate, abnormal	w18Tg + MO1-reck	Fig. 7 from Prendergast et al., 2012
parachordal vessel absent, abnormal	y1Tg + MO1-reck	Fig. 5 from Prendergast et al., 2012
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal	ia4Tg; s896Tg + MO1-reck	Fig. 3 from Vanhollebeke et al., 2015

Phenotype of all Fish created by or utilizing MO1-reck

Phenotype	Fish	Conditions	Figures
central artery absent, abnormal	s843Tg + MO1-reck	standard conditions	Fig. 2 from Vanhollebeke et al., 2015
brain vasculature absent, abnormal	s843Tg + MO1-reck	standard conditions	Fig. 2 from Vanhollebeke et al., 2015
hindbrain central artery absent, abnormal	s843Tg + MO1-reck	standard conditions	Fig. 2 from Vanhollebeke et al., 2015
neural crest cell migration increased rate, abnormal	w18Tg + MO1-reck	standard conditions	Fig. 7 from Prendergast et al., 2012
head hemorrhagic, abnormal	y1Tg + MO1-reck	standard conditions	Fig. 5 from Prendergast et al., 2012
parachordal vessel absent, abnormal	y1Tg + MO1-reck	standard conditions	Fig. 5 from Prendergast et al., 2012
hindbrain central artery absent, abnormal	ia4Tg; s896Tg + MO1-reck	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal	ia4Tg; s896Tg + MO1-reck	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal	ia4Tg; s896Tg + MO1-reck	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
dorsal root ganglion Wnt signaling pathway decreased process quality, abnormal	ia4Tg; vu234Tg + MO1-reck	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
neural crest cell migration decreased rate, abnormal	w18Tg; w69Tg + MO1-reck	standard conditions	Fig. 7 from Prendergast et al., 2012
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal	ncv15Tg; ncv1Tg; nkuasgfp1aTg + MO1-reck	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
basilar artery Wnt signaling pathway decreased process quality, abnormal	ncv15Tg; ncv1Tg; nkuasgfp1aTg + MO1-reck	standard conditions	Fig. 3 from Vanhollebeke et al., 2015

Citations