Morpholino

MO3-mcamb

ID
ZDB-MRPHLNO-101216-2
Name
MO3-mcamb
Previous Names
  • gicerin MO (1)
Target
Sequence
5' - AGCAGTGCGGTGTAGGTCATTTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mcamb
Expressed Gene Anatomy Figures
aplnra Fig. 5 with image from Yan et al., 2017
axin2 Fig. 6 from Ye et al., 2013
ctslb Fig. 5 from Ye et al., 2013
dharma Fig. 6 from Ye et al., 2013
dll4 Fig. 5 with image from Yan et al., 2017
dlx3b Fig. 5 from Ye et al., 2013
efnb2a Fig. 5 with image from Yan et al., 2017
Fig. 3 from So et al., 2010
fli1 Fig. 3Fig. S1 from So et al., 2010
flt4 Fig. 5 with image from Yan et al., 2017
Fig. 3 from So et al., 2010
foxa3 Fig. 4 with image from Gao et al., 2017
gata1a Fig. 3 from So et al., 2010
gsc Fig. 5 from Ye et al., 2013
kdr Fig. 3 from So et al., 2010
kdrl Fig. 3 from So et al., 2010
lyve1b Fig. S5 with image from Yan et al., 2017
myl7 Fig. 4 with image from Gao et al., 2017
myod1 Fig. 5 from Ye et al., 2013
Fig. S1 from So et al., 2010
prox1a Fig. S5 with image from Yan et al., 2017
prox3 Fig. S5 with image from Yan et al., 2017
spaw Fig. 3 with image from Gao et al., 2017
tbx20 Fig. 5 with image from Yan et al., 2017
tbxta Fig. 5 from Ye et al., 2013
vent Fig. 6 from Ye et al., 2013
vox Fig. 6 from Ye et al., 2013
Phenotype
Phenotype resulting from MO3-mcamb
Phenotype Fish Figures
angiogenesis arrested, abnormal WT + MO3-mcamb Fig. 3 from So et al., 2010
angiogenesis disrupted, abnormal la116Tg + MO3-mcamb Fig. 3Fig. 4 from So et al., 2010
blood circulation disrupted, abnormal WT + MO3-mcamb Fig. 3 from So et al., 2010
blood vessel endothelial cell migration decreased process quality, abnormal is5Tg; y7Tg + MO3-mcamb Fig. S6 from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal is5Tg; y7Tg + MO3-mcamb Fig. S6 from Tu et al., 2015
convergent extension process quality, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
determination of digestive tract left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb Fig. 4 with image from Gao et al., 2017
determination of intestine left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb Fig. 4 with image from Gao et al., 2017
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb Fig. 4 with image from Gao et al., 2017
dorsal longitudinal anastomotic vessel aplastic, abnormal la116Tg + MO3-mcamb Fig. 4 from So et al., 2010
epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
heart looping decreased occurrence, abnormal TU + MO3-mcamb Fig. 4 with image from Gao et al., 2017
intersegmental vessel aplastic, abnormal WT + MO3-mcamb Fig. 3 from So et al., 2010
intersegmental vessel decreased amount, abnormal la116Tg; vu19Tg + MO3-mcamb Fig. 3 from So et al., 2010
intersegmental vessel decreased length, abnormal la116Tg + MO3-mcamb Fig. 4 from So et al., 2010
intersegmental vessel hypoplastic, abnormal la116Tg; vu19Tg + MO3-mcamb Fig. 3 from So et al., 2010
intersegmental vessel endothelial cell decreased amount, abnormal is5Tg; y7Tg + MO3-mcamb Fig. 6 with image from Tu et al., 2015
Kupffer's vesicle decreased size, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle lumenized, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle shape, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle unlumenized, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle anatomical region decreased volume, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle anatomical space decreased volume, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle cilium decreased length, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
Kupffer's vesicle tube formation decreased occurrence, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
lateral plate mesoderm spaw expression spatial pattern, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
lateral plate mesoderm right side spaw expression spatial pattern, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb Fig. 5 with image from Yan et al., 2017
lymphangiogenic sprout decreased amount, abnormal y1Tg + MO3-mcamb Fig. 5 with image from Yan et al., 2017
neuroectoderm dlx3b expression spatial pattern, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
notochord increased width, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
notochord tbxta expression spatial pattern, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
pericardium edematous, abnormal WT + MO3-mcamb Fig. 3 from So et al., 2010
prechordal plate ctslb expression spatial pattern, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
somite morphology, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
somite myod1 expression spatial pattern, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
thoracic duct absent, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct prox3 expression decreased amount, abnormal TU + MO3-mcamb Fig. S5 with image from Yan et al., 2017
thoracic duct prox1a expression decreased amount, abnormal TU + MO3-mcamb Fig. S5 with image from Yan et al., 2017
thoracic duct lyve1b expression decreased amount, abnormal TU + MO3-mcamb Fig. S5 with image from Yan et al., 2017
thoracic duct decreased amount, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct decreased functionality, abnormal ci5Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct decreased length, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct malformed, abnormal ci5Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
vascular lymphangioblast absent, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
vascular lymphangioblast lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
vasculature development disrupted, abnormal la116Tg + MO3-mcamb Fig. 6 with image from Tu et al., 2015
whole organism ab21-mapk labeling decreased amount, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
whole organism axin2 expression decreased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism ab14-ctnnb labeling increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism vent expression increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism vox expression increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism lacks all parts of type parachordal vessel, abnormal la116Tg + MO3-mcamb Fig. 6 with image from Tu et al., 2015
whole organism dorsal region dharma expression increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism dorsal region dharma expression increased distribution, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism ventral region vent expression increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism ventral region vent expression increased distribution, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
Phenotype of all Fish created by or utilizing MO3-mcamb
Phenotype Fish Conditions Figures
whole organism ab14-ctnnb labeling increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
neuroectoderm dlx3b expression spatial pattern, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
lateral plate mesoderm spaw expression spatial pattern, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
thoracic duct prox3 expression decreased amount, abnormal TU + MO3-mcamb standard conditions Fig. S5 with image from Yan et al., 2017
whole organism ventral region vent expression increased distribution, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
notochord increased width, abnormal TU + MO3-mcamb standard conditions Fig. 5 from Ye et al., 2013
Kupffer's vesicle cilium decreased length, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
prechordal plate ctslb expression spatial pattern, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
somite myod1 expression spatial pattern, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
convergent extension process quality, abnormal TU + MO3-mcamb standard conditions Fig. 5 from Ye et al., 2013
whole organism ab21-mapk labeling decreased amount, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
thoracic duct lyve1b expression decreased amount, abnormal TU + MO3-mcamb standard conditions Fig. S5 with image from Yan et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 4 with image from Gao et al., 2017
heart looping decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 4 with image from Gao et al., 2017
thoracic duct prox1a expression decreased amount, abnormal TU + MO3-mcamb standard conditions Fig. S5 with image from Yan et al., 2017
whole organism dorsal region dharma expression increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
whole organism axin2 expression decreased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
whole organism dorsal region dharma expression increased distribution, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
somite morphology, abnormal TU + MO3-mcamb standard conditions Fig. 5 from Ye et al., 2013
determination of digestive tract left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 4 with image from Gao et al., 2017
notochord tbxta expression spatial pattern, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
whole organism ventral region vent expression increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
whole organism vent expression increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
whole organism vox expression increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
lateral plate mesoderm right side spaw expression spatial pattern, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
determination of intestine left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 4 with image from Gao et al., 2017
intersegmental vessel aplastic, abnormal WT + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
blood circulation disrupted, abnormal WT + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
pericardium edematous, abnormal WT + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
angiogenesis arrested, abnormal WT + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
thoracic duct malformed, abnormal ci5Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct decreased functionality, abnormal ci5Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
whole organism lacks all parts of type parachordal vessel, abnormal la116Tg + MO3-mcamb standard conditions Fig. 6 with image from Tu et al., 2015
vasculature development disrupted, abnormal la116Tg + MO3-mcamb standard conditions Fig. 6 with image from Tu et al., 2015
angiogenesis disrupted, abnormal la116Tg + MO3-mcamb standard conditions Fig. 4 from So et al., 2010
intersegmental vessel decreased length, abnormal la116Tg + MO3-mcamb standard conditions Fig. 4 from So et al., 2010
dorsal longitudinal anastomotic vessel aplastic, abnormal la116Tg + MO3-mcamb standard conditions Fig. 4 from So et al., 2010
Kupffer's vesicle decreased size, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle lumenized, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle anatomical region decreased volume, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle unlumenized, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle tube formation decreased occurrence, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle shape, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle anatomical space decreased volume, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb standard conditions Fig. 5 with image from Yan et al., 2017
thoracic duct decreased amount, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct decreased length, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
vascular lymphangioblast absent, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct absent, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct malformed, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
lymphangiogenic sprout decreased amount, abnormal y1Tg + MO3-mcamb standard conditions Fig. 5 with image from Yan et al., 2017
vascular lymphangioblast lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
blood vessel endothelial cell migration decreased process quality, abnormal is5Tg; y7Tg + MO3-mcamb standard conditions Fig. S6 from Tu et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal is5Tg; y7Tg + MO3-mcamb standard conditions Fig. 6 with image from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal is5Tg; y7Tg + MO3-mcamb standard conditions Fig. S6 from Tu et al., 2015
intersegmental vessel decreased amount, abnormal la116Tg; vu19Tg + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
angiogenesis disrupted, abnormal la116Tg; vu19Tg + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
intersegmental vessel hypoplastic, abnormal la116Tg; vu19Tg + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
Citations