Morpholino

MO1-hspb1

ID
ZDB-MRPHLNO-100512-4
Name
MO1-hspb1
Previous Names
None
Target
Sequence
5' - GTTTTGAAGAGTTGTTTTTCGGCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO, targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hspb1
Expressed Gene Anatomy Figures
hspb1 Fig. 3 from Middleton et al., 2013
Fig. 1 from Tucker et al., 2009
Phenotype
Phenotype resulting from MO1-hspb1
Phenotype Fish Figures
adductor mandibulae decreased thickness, abnormal WT + MO1-hspb1 Fig. 4,  Fig. 6 from Middleton et al., 2013
adductor mandibulae muscle cell decreased size, abnormal WT + MO1-hspb1 Fig. 5,  Fig. 6 from Middleton et al., 2013
adductor mandibulae regulation of myofibril size disrupted, abnormal WT + MO1-hspb1 Fig. 6 from Middleton et al., 2013
interhyoideus decreased thickness, abnormal WT + MO1-hspb1 Fig. 4,  Fig. 6 from Middleton et al., 2013
interhyoideus muscle cell decreased size, abnormal WT + MO1-hspb1 Fig. 5,  Fig. 6 from Middleton et al., 2013
interhyoideus regulation of myofibril size disrupted, abnormal WT + MO1-hspb1 Fig. 6 from Middleton et al., 2013
medial rectus decreased thickness, abnormal WT + MO1-hspb1 Fig. 4 from Middleton et al., 2013
muscle cell development disrupted, abnormal WT + MO1-hspb1 Fig. 4,  Fig. 6 from Middleton et al., 2013
peripheral neuron axon absent, abnormal AB/EKW + MO1-hspb1 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-hspb1 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-hspb1 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-hspb1 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-hspb1 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
Phenotype of all Fish created by or utilizing MO1-hspb1
Phenotype Fish Conditions Figures
peripheral neuron axon shape, abnormal AB/EKW + MO1-hspb1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-hspb1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon absent, abnormal AB/EKW + MO1-hspb1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-hspb1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-hspb1 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
muscle cell development disrupted, abnormal WT + MO1-hspb1 standard conditions Fig. 4,  Fig. 6 from Middleton et al., 2013
interhyoideus regulation of myofibril size disrupted, abnormal WT + MO1-hspb1 standard conditions Fig. 6 from Middleton et al., 2013
adductor mandibulae decreased thickness, abnormal WT + MO1-hspb1 standard conditions Fig. 4,  Fig. 6 from Middleton et al., 2013
interhyoideus muscle cell decreased size, abnormal WT + MO1-hspb1 standard conditions Fig. 5,  Fig. 6 from Middleton et al., 2013
adductor mandibulae regulation of myofibril size disrupted, abnormal WT + MO1-hspb1 standard conditions Fig. 6 from Middleton et al., 2013
medial rectus decreased thickness, abnormal WT + MO1-hspb1 standard conditions Fig. 4 from Middleton et al., 2013
adductor mandibulae muscle cell decreased size, abnormal WT + MO1-hspb1 standard conditions Fig. 5,  Fig. 6 from Middleton et al., 2013
interhyoideus decreased thickness, abnormal WT + MO1-hspb1 standard conditions Fig. 4,  Fig. 6 from Middleton et al., 2013
peripheral neuron axon shape, abnormal AB/EKW + MO1-hspb1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-hspb1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-hspb1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-hspb1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.