Morpholino

MO1-foxd3

ID

ZDB-MRPHLNO-050818-7

Name

MO1-foxd3

Previous Names

None

Target

foxd3 (1)

Sequence

5' - TGCTGCTGGAGCAACCCAAGGTAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxd3

Expressed Gene	Anatomy	Figures
actc1b	adaxial cell	Fig. 7 from Lee et al., 2006
aox5	pigment cell	Fig. 5 from Lister et al., 2006
crestin	neural crest	Fig. 3 from Lister et al., 2006
dct	melanoblast trunk	Fig. 4 from Cooper et al., 2009 Fig. 5 from Lister et al., 2006
dlx2a	neural crest	Fig. 4 from Lister et al., 2006
ednrba	(not) iridophore	Fig. 5 from Lister et al., 2006
egr2b	central nervous system lateral line	Fig. S4 from Lister et al., 2006
foxd3	(not) neural crest (not) presumptive enteric nervous system somite (not) whole organism	Fig. 3 , Fig. 6 , Fig. S1 , Fig. S2 from Lister et al., 2006
gsc	pharyngeal arch cartilage	Fig. 4 from Lister et al., 2006
mbpa	central nervous system glial cell (not) lateral line	Fig. 7 from Lister et al., 2006
mitfa	head neural crest cell trunk anterior region	Fig. 4 from Cooper et al., 2009 Fig. S2 from Lister et al., 2006
myf5	adaxial cell segmental plate somite tail bud	Fig. 6 , Fig. 7 from Lee et al., 2006
myod1	adaxial cell segmental plate somite	Fig. 7 from Lee et al., 2006
myog	adaxial cell	Fig. 7 from Lee et al., 2006
neurog1	(not) dorsal root ganglion spinal cord	Fig. 6 from Lister et al., 2006
phox2bb	(not) presumptive enteric nervous system	Fig. 6 from Lister et al., 2006
pou3f1	central nervous system lateral line	Fig. S4 from Lister et al., 2006
ret	(not) presumptive enteric nervous system	Fig. 6 from Lister et al., 2006
snai1b	neural crest	Fig. 3 from Lister et al., 2006
sox10	neural crest	Fig. 3 from Lister et al., 2006
tfap2a	neural crest	Fig. S2 from Lister et al., 2006

Phenotype

Phenotype resulting from MO1-foxd3

Phenotype	Fish	Figures
dorsal root ganglion decreased amount, abnormal	w61Tg + MO1-foxd3	Fig. 5 from McGraw et al., 2008
head decreased size, abnormal	WT + MO1-foxd3	Fig. 5 from Lee et al., 2006
somite increased width, abnormal	WT + MO1-foxd3	Fig. 5 from Lee et al., 2006
somite border irregular spatial pattern, abnormal	WT + MO1-foxd3	Fig. 5 from Lee et al., 2006
tail bud morphology, abnormal	WT + MO1-foxd3	Fig. 5 from Lee et al., 2006

Phenotype of all Fish created by or utilizing MO1-foxd3

Phenotype	Fish	Conditions	Figures
tail bud morphology, abnormal	WT + MO1-foxd3	standard conditions	Fig. 5 from Lee et al., 2006
somite border irregular spatial pattern, abnormal	WT + MO1-foxd3	standard conditions	Fig. 5 from Lee et al., 2006
head decreased size, abnormal	WT + MO1-foxd3	standard conditions	Fig. 5 from Lee et al., 2006
somite increased width, abnormal	WT + MO1-foxd3	standard conditions	Fig. 5 from Lee et al., 2006
dorsal root ganglion decreased amount, abnormal	w61Tg + MO1-foxd3	standard conditions	Fig. 5 from McGraw et al., 2008
iridophore decreased amount, abnormal	kita^j1e60/j1e60 + MO1-foxd3	standard conditions	Fig. 5 from Cooper et al., 2009
melanocyte apoptotic, abnormal	kita^w34b/w34b + MO1-foxd3 (AB)	standard conditions	Fig. 7 from Cooper et al., 2009
melanocyte decreased amount, abnormal	kita^w34b/w34b + MO1-foxd3 (AB)	standard conditions	Fig. 2 from Cooper et al., 2009
iridophore increased amount, abnormal	mitfa^w2/w2 + MO1-foxd3 (AB)	standard conditions	Fig. S2 from Curran et al., 2010

Citations