Morpholino

MO1-tbxta

ID
ZDB-MRPHLNO-050221-3
Name
MO1-tbxta
Previous Names
  • MO1-ntl
  • MO1-ta
  • ntl MO (1)
  • ntl-MO (1)
Target
Sequence
5' - GACTTGAGGCAGGCATATTTCCGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Characterized by a normal head, abnormal somites and a reduced tail.
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbxta
Expressed Gene Anatomy Figures
dand5 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Gourronc et al., 2007
enc3 Fig. 4 with image from Qian et al., 2013
fgf3 Fig. 4 with image from Osborn et al., 2020
fgf4 Fig. 4 with image from Osborn et al., 2020
fgf8a Fig. 4 with image from Osborn et al., 2020
lft1 Fig. 3 from Amack et al., 2004
lft2 Fig. 3 from Amack et al., 2004
myf5 Fig. 4 with image from Osborn et al., 2020
myod1 Fig. 4 with image from Osborn et al., 2020
nphs1 Fig. 8 with image from Huang et al., 2013
nphs2 Fig. 8 with image from Huang et al., 2013
pdia6 Fig. 2 with image from Gourronc et al., 2007
pitx2 Fig. 4 from Burdine et al., 2016
shha Fig. 2 with image from Gourronc et al., 2007
slc20a1a Fig. 8 with image from Huang et al., 2013
sox17 text only from Amack et al., 2007
spaw Fig. 4 with image from Pelliccia et al., 2017
Fig. 2 with image from Gourronc et al., 2007
tbx16 Fig. 6 with image from Amack et al., 2007
tbxta Fig. 6 with image from Amack et al., 2007
Fig. 2 with image,  Fig. 3 with image from Gourronc et al., 2007
Fig. 2 from Amack et al., 2004
Phenotype
Phenotype resulting from MO1-tbxta
Phenotype Fish Figures
axial chorda mesoderm fgf8a expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO1-tbxta Fig. 7 with image from Francescatto et al., 2010
determination of digestive tract left/right asymmetry decreased process quality, abnormal pd24Tg + MO1-tbxta Fig. 6 with image from Hochgreb-Hägele et al., 2013
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-tbxta Fig. 2 with image from Hatler et al., 2009
embryonic heart tube left/right pattern formation process quality, abnormal twu34Tg + MO1-tbxta Fig. 1 with image from Lenhart et al., 2013
epithalamus determination of left/right symmetry disrupted, abnormal WT + MO1-tbxta Fig. T1 with image from Roussigné et al., 2009
habenula determination of left/right symmetry disrupted, abnormal WT + MO1-tbxta Fig. 5 with image from Roussigné et al., 2009
habenula neurogenesis process quality, abnormal WT + MO1-tbxta Fig. 5 with image from Roussigné et al., 2009
heart looping disrupted, abnormal WT + MO1-tbxta Fig. 2 with image from Hatler et al., 2009
heart rudiment cardioblast anterior-lateral migration process quality, abnormal twu34Tg + MO1-tbxta Fig. 1 with image from Lenhart et al., 2013
heart tube mislocalised radially, abnormal WT + MO1-tbxta Fig. 2 with image from Hatler et al., 2009
Kupffer's vesicle unlumenized, abnormal AB + MO1-tbxta Fig. 7 with image from Amack et al., 2007
lateral mesoderm morphogenesis decreased process quality, abnormal pd24Tg + MO1-tbxta Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm bilateral symmetry, abnormal pd24Tg + MO1-tbxta Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm mislocalised, abnormal pd24Tg + MO1-tbxta Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-tbxta Fig. 4 with image from Pelliccia et al., 2017
margin fgf8a expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
nodal signaling pathway disrupted, abnormal WT + MO1-tbxta Fig. 5 with image from Roussigné et al., 2009
notochord posterior-most region fgf3 expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf4 expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf8a expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
post-vent region aplastic, abnormal WT + MO1-tbxta Fig. 5 with image from Robu et al., 2007
post-vent region shape, abnormal AB + MO1-tbxta Fig. 8 with image from Amack et al., 2007
presumptive paraxial mesoderm myod1 expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
protein autophosphorylation arrested, abnormal WT + MO1-tbxta Fig. 7 with image from Francescatto et al., 2010
segmental plate adaxial cell myod1 expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myf5 expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
somite adaxial cell myod1 expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
tail bud myf5 expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
trunk morphology, abnormal AB + MO1-tbxta Fig. 8 with image from Amack et al., 2007
whole organism decreased length, abnormal WT + MO1-tbxta Fig. 4 from Burdine et al., 2016
Phenotype of all Fish created by or utilizing MO1-tbxta
Phenotype Fish Conditions Figures
post-vent region shape, abnormal AB + MO1-tbxta standard conditions Fig. 8 with image from Amack et al., 2007
Kupffer's vesicle unlumenized, abnormal AB + MO1-tbxta standard conditions Fig. 7 with image from Amack et al., 2007
trunk morphology, abnormal AB + MO1-tbxta standard conditions Fig. 8 with image from Amack et al., 2007
nodal signaling pathway disrupted, abnormal WT + MO1-tbxta standard conditions Fig. 5 with image from Roussigné et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-tbxta standard conditions Fig. 2 with image from Hatler et al., 2009
segmental plate adaxial cell myf5 expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
tail bud myf5 expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
whole organism decreased length, abnormal WT + MO1-tbxta standard conditions Fig. 4 from Burdine et al., 2016
tail bud myod1 expression absent, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
somite adaxial cell myod1 expression absent, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
tail bud myf5 expression increased amount, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
habenula determination of left/right symmetry disrupted, abnormal WT + MO1-tbxta standard conditions Fig. 5 with image from Roussigné et al., 2009
notochord posterior-most region fgf4 expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
protein autophosphorylation arrested, abnormal WT + MO1-tbxta standard conditions Fig. 7 with image from Francescatto et al., 2010
calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO1-tbxta standard conditions Fig. 7 with image from Francescatto et al., 2010
heart looping disrupted, abnormal WT + MO1-tbxta standard conditions Fig. 2 with image from Hatler et al., 2009
epithalamus determination of left/right symmetry disrupted, abnormal WT + MO1-tbxta standard conditions Fig. T1 with image from Roussigné et al., 2009
adaxial cell myf5 expression decreased distribution, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
margin fgf8a expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-tbxta control Fig. 4 with image from Pelliccia et al., 2017
segmental plate adaxial cell myod1 expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
post-vent region aplastic, abnormal WT + MO1-tbxta standard conditions Fig. 5 with image from Robu et al., 2007
somite adaxial cell myod1 expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myod1 expression absent, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
habenula neurogenesis process quality, abnormal WT + MO1-tbxta standard conditions Fig. 5 with image from Roussigné et al., 2009
notochord posterior-most region fgf8a expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
heart tube mislocalised radially, abnormal WT + MO1-tbxta standard conditions Fig. 2 with image from Hatler et al., 2009
notochord posterior-most region fgf3 expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myod1 expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
axial chorda mesoderm fgf8a expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
post-vent region aplastic, abnormal WT + MO1-tbxta + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
determination of digestive tract left/right asymmetry decreased process quality, abnormal pd24Tg + MO1-tbxta standard conditions Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral mesoderm morphogenesis decreased process quality, abnormal pd24Tg + MO1-tbxta standard conditions Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm mislocalised, abnormal pd24Tg + MO1-tbxta standard conditions Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm bilateral symmetry, abnormal pd24Tg + MO1-tbxta standard conditions Fig. 6 with image from Hochgreb-Hägele et al., 2013
heart rudiment cardioblast anterior-lateral migration process quality, abnormal twu34Tg + MO1-tbxta standard conditions Fig. 1 with image from Lenhart et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal twu34Tg + MO1-tbxta standard conditions Fig. 1 with image from Lenhart et al., 2013
post-vent region shape, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
Kupffer's vesicle ciliated cell absent, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
trunk morphology, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
lateral plate mesoderm spaw expression absent, abnormal WT + MO1-tbxta + MO2-gdf3 control Fig. 4 with image from Pelliccia et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.